You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript. Adipose tissue homeostasis depends on an intact vascular network that ensures adequate nutrient delivery and immune regulation. In obesity, vascular dysfunction, particularly within endothelial cells (ECs), contributes to inflammation and metabolic disease progression, yet the cellular organization of the human adipose vasculature remains poorly defined. Here we show, using single-cell RNA sequencing of nearly 70,000 vascular cells from human subcutaneous adipose tissue of 65 individuals, that the adipose vasculature is highly heterogeneous and consists of seven canonical EC subtypes. In addition, we identify a distinct population of ECs that display mixed endothelial, mesenchymal, adipocytic and immune transcriptional features. Computational analyses and whole-mount imaging support their presence and suggest that they emerge through endothelial-to-mesenchymal transition. Comparative analyses further reveal inflammatory and fibrotic vascular signatures in obesity and type 2 diabetes. Together, this atlas delineates the cellular complexity of the human adipose vasculature and highlights its contribution to metabolic disease. This is a preview of subscription content, access via your institution Get Nature+, our best-value online-access subscription Receive 12 digital issues and online access to articles Prices may be subject to local taxes which are calculated during checkout The raw sequencing data generated in this study are available at Gene Expression Omnibus (GEO) under the accession code GSE268904. Publicly available datasets were downloaded from their respective repositories; GEO database under the accession codes GSE176171, GSE129363, GSE155960, GSE128889, GSE241015, GSE235192, Single Cell Portal (SCP) with accession code SCP1903 and EMBL-EBI with accession code E-MTAB-12865. Data from Massier et al. were obtained after contacting the authors. Raw imaging data can be made available upon reasonable request. To enhance the value of our resource, we offer access to the dataset described in this work through: https://dreamapp.biomed.au.dk/Kalucka-lab/SAT-vascular_atlas/. Source data are provided with this paper. The scripts utilized for the analysis done in this study can be accessed via GitHub at https://github.com/Kalucka-lab/SAT_Atlas. AlZaim, I., de Rooij, L. P., Sheikh, B. N., Börgeson, E. & Kalucka, J. The evolving functions of the vasculature in regulating adipose tissue biology in health and obesity. & Kalucka, J. Angiogenesis in adipose tissue: the interplay between adipose and endothelial cells. & Kalucka, J. Adipose tissue endothelial cells: insights into their heterogeneity and functional diversity. Towards a consensus atlas of human and mouse adipose tissue at single-cell resolution. Kalucka, J. et al. Single-cell transcriptome atlas of murine endothelial cells. Li, J. et al. Neurotensin is an anti-thermogenic peptide produced by lymphatic endothelial cells. Hasan, S. S. et al. Obesity drives depot-specific vascular remodeling in male white adipose tissue. Amersfoort, J., Eelen, G. & Carmeliet, P. Immunomodulation by endothelial cells—partnering up with the immune system?. Chavkin, N. W. et al. Obesity accelerates endothelial-to-mesenchymal transition in adipose tissues of mice and humans. Dhumale, P. et al. CD31 defines a subpopulation of human adipose-derived regenerative cells with potent angiogenic effects. Bäckdahl, J. et al. Spatial mapping reveals human adipocyte subpopulations with distinct sensitivities to insulin. van Splunder, H., Villacampa, P., Martínez-Romero, A. & Graupera, M. Pericytes in the disease spotlight. Wilhelm, K. et al. FOXO1 couples metabolic activity and growth state in the vascular endothelium. Jeong, H.-W. et al. Transcriptional regulation of endothelial cell behavior during sprouting angiogenesis. Kakogiannos, N. et al. JAM-A acts via C/EBP-α to promote claudin-5 expression and enhance endothelial barrier function. Reyes-Palomares, A. et al. Remodeling of active endothelial enhancers is associated with aberrant gene-regulatory networks in pulmonary arterial hypertension. Hoshino, A. et al. Gain-of-function IKZF1 variants in humans cause immune dysregulation associated with abnormal T/B cell late differentiation. Boutboul, D. et al. Dominant-negative IKZF1 mutations cause a T, B, and myeloid cell combined immunodeficiency. Lv, L., Meng, Q., Ye, M., Wang, P. & Xue, G. STAT4 deficiency protects against neointima formation following arterial injury in mice. Mognol, G. P., Carneiro, F. R. G., Robbs, B. K., Faget, D. V. & Viola, J. P.dB. Cell cycle and apoptosis regulation by NFAT transcription factors: new roles for an old player. Emont, M. P. et al. A single-cell atlas of human and mouse white adipose tissue. Wang, F. et al. Endothelial cell heterogeneity and microglia regulons revealed by a pig cell landscape at single-cell level. Arbee, S. et al. Versican maintains the homeostasis of adipose tissues and regulates energy metabolism. Han, C. Y. et al. Adipocyte-derived versican and macrophage-derived biglycan control adipose tissue inflammation in obesity. Ahmad, R., Rah, B., Bastola, D., Dhawan, P. & Singh, A. B. Obesity-induces organ and tissue specific tight junction restructuring and barrier deregulation by claudin switching. & Chang, J. Obesity-induced blood-brain barrier dysfunction: phenotypes and mechanisms. Liu, Y. et al. Shear stress activation of SREBP1 in endothelial cells is mediated by integrins. Shimano, H. et al. Sterol regulatory element-binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes. Ong, Y. T. et al. A YAP/TAZ-TEAD signalling module links endothelial nutrient acquisition to angiogenic growth. Cai, X., Wang, K. C. & Meng, Z. Mechanoregulation of YAP and TAZ in cellular homeostasis and disease progression. Taylor, J. et al. Endothelial Notch1 signaling in white adipose tissue promotes cancer cachexia. Franco, C. A. et al. Serum response factor is required for sprouting angiogenesis and vascular integrity. Andueza, A. et al. Endothelial reprogramming by disturbed flow revealed by single-cell RNA and chromatin accessibility study. Piera-Velazquez, S. & Jimenez, S. A. Endothelial to mesenchymal transition: role in physiology and in the pathogenesis of human diseases. The vascular endothelium of the adipose tissue gives rise to both white and brown fat cells. Massier, L. et al. An integrated single cell and spatial transcriptomic map of human white adipose tissue. Dheedene, W. et al. Loss of endothelial ZEB2 in mice attenuates steatosis early during metabolic dysfunction-associated steatotic liver disease. Tardajos-Ayllon, B. et al. TWIST1 drives endothelial-to-mesenchymal-transition to stabilize atherosclerotic plaques. Ren, J. et al. Single-cell sequencing reveals that endothelial cells, EndMT cells and mural cells contribute to the pathogenesis of cavernous malformations. Pierce, A. D. et al. Glucose-activated RUNX2 phosphorylation promotes endothelial cell proliferation and an angiogenic phenotype. Mochin, M. T. et al. Hyperglycemia and redox status regulate RUNX2 DNA-binding and an angiogenic phenotype in endothelial cells. Inouye, K. E. et al. Endothelial-derived FABP4 constitutes the majority of basal circulating hormone and regulates lipolysis-driven insulin secretion. Suttorp, N., Weber, U., Welsch, T. & Schudt, C. Role of phosphodiesterases in the regulation of endothelial permeability in vitro. MacKeil, J. L. et al. Phosphodiesterase 3B (PDE3B) antagonizes the anti-angiogenic actions of PKA in human and murine endothelial cells. Zhu, Z., Chambers, S. & Bhatia, M. Substance P promotes leukocyte infiltration in the liver and lungs of mice with sepsis: a key role for adhesion molecules on vascular endothelial cells. Bhatia, M. et al. Role of substance P and the neurokinin 1 receptor in acute pancreatitis and pancreatitis-associated lung injury. Potential therapeutic effect of NK1R antagonist in diabetic non-healing wound and depression. Single cell full-length transcriptome of human subcutaneous adipose tissue reveals unique and heterogeneous cell populations. Nasim, S. et al. CD45 is sufficient to initiate endothelial-to-mesenchymal transition in human endothelial cells—brief report. Partial endothelial-to-mesenchymal transition mediated by HIF-induced CD45 in neointima formation upon carotid artery ligation. Tombor, L. S. et al. Immunoregulatory endothelial cells interact with T cells after myocardial infarction. Shao, X. et al. MatrisomeDB 2.0: 2023 updates to the ECM-protein knowledge database. Dunaway, L. S. et al. Obesogenic diet disrupts tissue-specific mitochondrial gene signatures in the artery and capillary endothelium. Malagoli Tagliazucchi, G., Wiecek, A. J., Withnell, E. & Secrier, M. Genomic and microenvironmental heterogeneity shaping epithelial-to-mesenchymal trajectories in cancer. Zhang, M. J. et al. Polygenic enrichment distinguishes disease associations of individual cells in single-cell RNA-seq data. The druggable genome and support for target identification and validation in drug development. Sakaue, S. & Okada, Y. GREP: genome for repositioning drugs. Bak, R. O., Dever, D. P. & Porteus, M. H. CRISPR/Cas9 genome editing in human hematopoietic stem cells. Galarraga, M. et al. Adiposoft: automated software for the analysis of white adipose tissue cellularity in histological sections. Behold cytometrists: one block is not enough! Cyanine-tandems bind non-specifically to human monocytes. Emmaneel, A. et al. PeacoQC: peak-based selection of high quality cytometry data. This work was supported by Lundbeckfonden (grant no. AUFF-E-2023-9-4) and Riisfort Fonden to J.K.; Novo Nordisk Foundation (grant no. ); Swedish Research Council (grant no. 2019-02046) and Karolinska Institutet (grant nos. HEU MSCA UNMET- 101155460); DFG-funded consortium SFB-Transregio 333, project ID 450149205 to J.H. ; internal KU Leuven funding (grant no. ; a fellowship from the Fonds voor Wetenschappelijk Onderzoek (FWO; grant no. has received personal honoraria from Amgen, AstraZeneca, Bayer, Boehringer Ingelheim, Daiichi-Sankyo, Lilly, Novo Nordisk, Novartis and Sanofi. Paulsen, D. Huylebroeck and A. Maestri for technical assistance, provision of materials and valuable discussions. We are also grateful to the study participants and the surgeons at the collaborating institutions for their involvement. These authors contributed equally: Ibrahim AlZaim, Mohamed N. Hassan. Ibrahim AlZaim, Mohamed N. Hassan, Maja Schröter, Luca Mannino, Katarina Dragicevic, Marie Balle Sjogaard, Joseph Festa, Lolita Dokshokova, Bettina Hansen, Rikke Kongsgaard Rasmussen, Julie N. Christensen, Olivia Wagman, Anja Bille Bohn, Jean Farup, Lin Lin, Anders Etzerodt, Robert A. Fenton, Niels Jessen & Joanna Kalucka Ibrahim AlZaim, Mohamed N. Hassan, Jean Farup, Lin Lin, Amanda Bæk, Niels Jessen & Joanna Kalucka Biotech Research and Innovation Centre, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark Helmholtz Institute for Metabolic Obesity and Vascular Research of the Helmholtz Zentrum München, University of Leipzig and University Hospital Leipzig, Leipzig, Germany Sophie Weinbrenner, Lucas Massier, Matthias Blüher & Bilal N. Sheikh Sophie Weinbrenner, Lucas Massier, Mikael Rydén & Niklas Mejhert Centre for Microvascular Research, William Harvey Research Institute, Barts and the London School of Medicine and Dentistry, Queen Mary University of London, London, UK Blanca Tardajos Ayllon & Paul Evans Division of Cardiovascular Medicine, Department of Medicine Solna, Karolinska Institutet, Stockholm, Sweden Ruby Schipper, Min Cai & Carolina E. Hagberg Center for Molecular Medicine, Karolinska University Hospital, Stockholm, Sweden Ruby Schipper, Min Cai & Carolina E. Hagberg Department of Cardiovascular Sciences, Center for Molecular and Vascular Biology, KU Leuven, Leuven, Belgium Bioinformatics Research Centre, Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark Anna Dalsgaard Thorsen & Henrik Holm Thomsen Amanda Bæk & Henrik Holm Thomsen Clinic for General, Visceral and Pediatric Surgery, University Medical Center Göttingen, Göttingen, Germany Maximilian von Heesen & Lena-Christin Conradi Department of Biochemistry and Molecular Cell Biology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center, Boston, MA, USA Broad Institute of MIT and Harvard, Cambridge, MA, USA Harvard Medical School, Boston, MA, USA Medical Department III—Endocrinology, Nephrology, Rheumatology, University of Leipzig Medical Center, Leipzig, Germany CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar led the bioinformatics work, with analyses conducted by I.A., M.N.H., L.M., K.D. were responsible for spatial transcriptomics. and N.J. provided biological samples, computational data, reagents and contributed to result interpretation. and J.K. wrote the manuscript, with figures prepared by I.A. All authors read, edited and approved the final version of the manuscript. The authors declare no competing interests. Nature Metabolism thanks Carlos Talavera-Lopez and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Primary Handling Editor: Revati Dewal, in collaboration with the Nature Metabolism team. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. a, Schematic overview of the workflow used to construct the human subcutaneous adipose tissue (SAT) atlas and the downstream analyses performed. b, UMAP projections of 329,774 cells grouped by cohort, shown before (raw data) and after integration using Harmony, scVI, and BBKNN. Table (bottom right) summarizes Graph LISI, ARI, and kBET scores for integration performance, with overall method ranking. c, UMAP of Harmony-integrated SAT data, colored by cluster annotation, metabolic state, and donor (each donor represented by a distinct bar). d, Violin plots showing the distribution of detected genes (top) and UMIs (bottom) per cell across major cell types in the SAT atlas. Violin plots depict kernel density estimates of single cell values with the embedded boxplot showing the median (center line), the interquartile range (box limits) and whiskers extending to the minimum and maximum values. e, UMAP projections split by cohort and technology (single-cell [SC] and single-nucleus [SN]). Bar graphs show the relative proportion of cell types as a percentage of all cells/nuclei per cohort. f, Dot plot of top marker gene expression for major cell populations. Dot size reflects the percentage of cells within a cluster expressing each gene; color indicates expression level (red: high, grey: low). g, Bar graph showing the proportion of vascular cells per cohort, split by technology. Each dot represents one cohort (n = 4 for SC and n = 5 for SN cohorts). h, Bar graphs showing the relative abundance of endothelial and mural cells as a percentage of all cells per donor, stratified by technology (SN and SC). P values were calculated using two-sided unpaired t-test (g) or one-way ANOVA (h). Exact P values are provided as Source Data. a, Feature plots showing gene signatures of distinct vascular cell populations in the human SAT atlas. Arrows highlight cells with enriched expression. b, Left: Dot plot illustrating the enrichment of interferon-related genes in AdECs from the V2 and C3 clusters. Dot size indicates the percentage of cells expressing each gene; color reflects expression level (red: high, grey: low). Right: Immunohistochemical staining of human SAT wholemounts showing protein-level expression of selected markers (MHC class II, IRF3, ISG15). White arrows indicate cells with pronounced expression. Scale bars: 50 μm c, Heatmap showing pathway activity scores inferred using PROGENy (Pathway RespOnsive GENes). d, Ridge plots showing normalized enrichment scores of immune- and ECM-related pathways, computed using scGSVA. e, Heatmap depicting the mean log2 fold changes of interferon-related genes in AdECs treated with IFN-γ, tumour necrosis factor (TNF), and TGF-β18. Asterisks indicate statistical significance (likelihood ratio test). f, Three-dimensional principal component analysis (PCA) based on pairwise Jaccard similarity coefficients of marker genes across vascular cell populations in the human SAT atlas. g, Violin plots showing cell-level distributions of matrisome-related gene signature scores across vascular cell populations in the SAT atlas. Violin plots depict kernel density estimates of single cell values with the embedded boxplot showing the median (center line), the interquartile range (box limits) and whiskers extending to the minimum and maximum values. h,i, Bar plots showing five representative Gene Ontology (GO) terms among the most significantly enriched pathways in endothelial cell populations (h) as well as lymphatic ECs, pericytes, and vascular smooth muscle cells (SM) (i). a, UMAP of single-cell transcriptomics data of clusters formed by murine SAT (inguinal adipose tissue) cells (left) and subset vascular cells (right) comprising endothelial, lymphatic, and mural cells. Bar graphs show the relative proportion of cell types as a percentage of all cells/nuclei. b, UMAP of single-cell transcriptomics data of clusters formed by porcine SAT cells (left) and subset vascular cells (right) comprising endothelial, lymphatic, and mural cells. Bar graphs show the relative proportion of cell types as a percentage of all cells/nuclei. c, Left: Violin plot showing the scmap similarity index between human and murine vascular cell populations. Right: Riverplot showing the relationship between human and murine vascular cell clusters. d, Left: Violin plot showing the scmap similarity index between human and porcine vascular cell populations. Right: Riverplot showing the relationship between human and porcine vascular cell clusters. e, UMAP of Human SAT vascular cells integrated using SysVI with either the murine (top) or the porcine vascular cells (bottom), split or grouped by species. f, Schematic diagram detailing the generation of SalsaiEC mice. g, Immunohistochemical validation of recombination following tamoxifen administration in SalsaiEC mice. h, Immunohistochemical validation of wholemount inguinal adipose tissue of SalsaiEC mice for proteins encoded by marker genes of sub-AdECs population. i, Contour plots of flow cytometry experiments showing the occurrence of sub-AdECs expressing CD45 (CD144/VE-Cadherin+CD31+CD45+ cells) and PDGFRA (CD144/VE-Cadherin+CD31+PDGFRA+ cells) within murine inguinal adipose tissue SVF. Scale bars (g, h): 50 μm. a, UMAP of vascular cells from the human SAT atlas grouped by metabolic state. c, Relative abundance of sequenced nuclei across major cell types in the SAT atlas. Boxplots show the proportion of cells per cell type across individual samples. d, Linear regression analysis showing the association between the abundance of sequenced nuclei from selected cell types (endothelial cells, mural cells, macrophages, and monocytes) and body mass index (BMI). e, Bar plot indicating the number of significant DEGs in each vascular cell population across three comparisons: Obese vs. Non-obese, Obese diabetic vs. Non-obese, and Obese diabetic vs. Obese. f, Bar plots displaying five representative GO terms among the most significantly upregulated and downregulated pathways in AdEC populations across the Obese vs. Non-obese and Obese diabetic vs. Non-obese comparisons. Bolded GO terms have been highlighted in the text. Statistics: Compositional differences between metabolic states were assessed using scCODA. Asterisks indicate cell types with statistically credible compositional changes as inferred by the Bayesian model (c). For regression analysis (d), p-values were calculated using the two-sided t-distribution. In all cases, P < 0.05 was considered statistically significant. a, Bar plots displaying five representative GO terms among the most significantly upregulated and downregulated pathways in mural cell populations across two comparisons: Obese vs. Non-obese and Obese diabetic vs. Non-obese. x-axis indicates the number of associated genes. b-d, Differential expression of extracellular matrix and endothelial marker genes across metabolic states. Violin plots show the expression levels of VCAN, VCAM1, CLDN5, COL1A1, COL1A2, and COL3A1 across the non-obese, obese, and obese diabetic conditions within the indicated cell populations. Each dot represents an individual cell/nucleus; Violin plots depict kernel density estimates of single cell values with the embedded boxplot showing the median (center line), the interquartile range (box limits) and whiskers extending to the minimum and maximum values. e, Top: Representative images of picrosirius red staining of human subcutaneous adipose tissue sections. f, Heatmaps depicting the inferred enrichment of transcription factor activity in each vascular cell population and in each metabolic state as inferred by deCoupleR. Only transcription factors exhibiting progressive trends towards increased or decreased activity in both metabolic disease states are presented. Transcription factors highlighted in red correspond to those discussed in the main text. Statistics: (b-d) Statistical significance was assessed using a two-sided Kruskal–Wallis test, followed by Wilcoxon rank-sum test for pairwise comparisons. P values are provided as Source Data. Boxplot (e) shows the median and the interquartile range and with whiskers presenting highest and lowest values and each point representing a distinct biological replicate. P value (e) was calculated using a two-sided unpaired t test. In all cases, P < 0.05 was considered statistically significant. a, UMAP of sub-AdECs from the human SAT atlas, grouped by metabolic state (Condition), cohort, and individual donor. Sub-AdECs were detected in donors across all metabolic states, including Non-obese, Obese, and Obese diabetic. Bar graphs show the relative proportion of cells as a percentage of all cells/nuclei. b, Bar plots showing the distribution of each sub-AdEC subpopulation across the three metabolic states (Non-obese, Obese, and Obese diabetic, left) and eight donor cohorts (right). c, Left: Feature plots showing expression of endothelial markers (PECAM1, CDH5, VWF, CD34, TEK) and mesenchymal markers (CD44, ZEB2) in sub-AdECs. Right: Corresponding expression of the same genes across vascular cell populations in the SAT atlas. Color scale indicates gene expression level (red: high, grey: low). d, Immunofluorescent staining of 3D-differentiated human adipose tissue organoids for tdTomato (magenta, ECs), PLIN1 (yellow; marker of the adipocyte-like endothelial cell population), BODIPY (white, lipid droplets), and Hoechst (cyan, nuclei). White arrowheads indicate tdTomato⁺ endothelial cells. e, Feature plots showing the expression of gene signatures from canonical vascular cell populations within sub-AdECs. Arrows indicate cells with enriched expression. f, Top: Median endothelial and mesenchymal scores for selected endothelial cell populations, ordered by average Monocle3 pseudotime values. Bottom: UMAP of in-house single-nucleus RNA-seq data showing the cell embeddings used to infer pseudotime trajectories using either Monocle3 or Palantir. g, Variation in gene expression (log(Expression + 1)) of selected genes and transcription factors along the Monocle3-inferred pseudotime trajectory. h, Force-directed graphs illustrating sub-AdEC transition from canonical AdECs. Shown are the original developmental flow vector field, the simulated TWIST1 perturbation vector field, and the associated perturbation scores and resulting flow field. Color scale indicates perturbation scores. i, Quantitative RT–PCR analysis of selected endothelial and mesenchymal genes in an in vitro model of EndMT (n = 9 biological replicates (distinct donors) for all genes, except VWF (n = 8) and ZEB2 (n = 10)). j, Top: Representative Western blots of VE-Cadherin, the EndMT transcription factors: SNAIL and ZEB2, the mesenchymal proteins CD44 and TAGLN, and the vascular adhesion molecule VCAM1 in vehicle-treated and EndMT-induced primary human AdECs at 3- and 7-days post-induction. Bottom: Quantification of VE-Cadherin, SNAIL, ZEB2, VCAM1, CD44, and TAGLN protein levels (n = 5 biological replicates (distinct donors) unless otherwise indicated (ZEB2, TAGLN and VCAM1 (only EndMT day7), n = 6). k, Top: Immunofluorescent images of primary human AdECs stained for VE-Cadherin, actin cytoskeleton, and ZEB2 (gray), with Hoechst counterstaining of nuclei, shown under vehicle-treated and EndMT-induced conditions. Bottom: Quantification of VE-cadherin and ZEB2 following EndMT induction. Total VE-cadherin fluorescence intensity normalized to Hoechst⁺ nuclei (left) and nuclear ZEB2 intensity (right) in EndMT-induced cells, shown relative to vehicle-treated controls. Each dot represents one independent biological replicate (distinct donor) (n = 8). l, Cell viability of EndMT-induced AdECs at day 7, normalized to vehicle-treated cells (n = 6 distinct donors); Quantification of CMFDA-labeled THP-1 cell binding to EndMT-induced AdECs (normalized to Hoechst⁺ nuclei and vehicle-treated controls, n = 5 distinct donors); Scratch area quantification at 18 hours post-wounding in EndMT-induced AdECs at day 7 (normalized to vehicle-treated controls, n = 7 distinct donors). Statistics: Boxplots (j-l) show the median and the interquartile range and with whiskers presenting highest and lowest values and each point representing a distinct biological replicate. Statistical significance was assessed using a two-sided one-sample t-test against the normalized control value. Exact P values are provided as Source Data. P < 0.05 was considered statistically significant. a, Schematic illustrating the experimental design for inducing obesity in Zeb2fl/fl and Zeb2ΔEC mice via Western diet (WD) feeding for 8 weeks. b, Left: Representative H&E-stained sections; Right: Adipocyte size quantification in epididymal adipose tissue (n = 8 distinct animals). c, Left: Representative Picrosirius Red-stained sections; Right: quantification of collagen deposition (n = 8 distinct animals). Black arrowheads highlight regions with pronounced Picrosirius Red staining. d, Left: Representative immunohistochemical staining for the macrophage marker F4/80; Right: corresponding quantification (normalized to Hoechst⁺ nuclei per image) (n = 8 distinct animals). White arrowheads indicate areas enriched in F4/80⁺ cells. e, Left: Representative images for the endothelial marker CD31 and the junctional protein VE-Cadherin; Right: quantification of total CD31⁺ area per image and VE-Cadherin intensity normalized to CD31⁺ area (n = 8; (Zeb2fl/fl Western Diet, CD31 area: n = 7 distinct animals)). White arrowheads indicate CD31⁺ vessels with pronounced VE-Cadherin expression. f, Schematic illustrating the experimental design for inducing dyslipidemia in Twist1fl/fl and Twist1ΔEC mice via Western/high-fat diet feeding for 14 weeks. g, Left: Representative H&E-stained sections; Right: adipocyte size quantification in inguinal adipose tissue of n = 7 and n = 8 distinct animals for Twist1fl/fl and Twist1ΔEC mice, respectively. h, Left: Representative Picrosirius Red–stained sections; Right: quantification of collagen deposition in Twist1fl/fl (n = 5) and Twist1ΔEC (n = 6 distinct animals) mice. Black arrowheads highlight regions with pronounced Picrosirius Red staining. i, Left: Representative F4/80 staining; Right: quantification of macrophage infiltration (normalized to Hoechst⁺ nuclei) (n = 8 distinct animals). White arrowheads indicate areas enriched in F4/80⁺ cells. j, Left: Representative staining for CD31 and VE-Cadherin; Right: quantification of CD31⁺ area and VE-Cadherin intensity (n = 8 (Twist1fl/fl, VE-Cadherin intensity: n = 7 distinct animals)). White arrowheads indicate CD31⁺ vessels with pronounced VE-Cadherin expression. Scale bars: 50μm Statistics: Boxplots show the median and the interquartile range and with whiskers presenting highest and lowest values and each point representing a distinct biological replicate. P values were calculated using two-sided unpaired t-tests (g-j) or one-way ANOVA (b-e). Exact P values are provided as Source Data. P < 0.05 was considered statistically significant. a, Bar plot showing the number of significant DEGs in each sub-AdEC subpopulation across three comparisons: Obese vs. Non-obese, Obese diabetic vs. Non-obese, and Obese diabetic vs. Obese. b, c, Bar plots displaying five representative GO terms among the most significantly upregulated and downregulated pathways in sub-AdEC subpopulations for the Obese vs. Non-obese and Obese diabetic vs. Non-obese comparisons. Bolded GO terms have been highlighted in the text. d, Violin plots showing matrisome-related gene signature scores across AdEC subpopulations. Scores for collagen, proteoglycan, glycoprotein, ECM-affiliated protein, secreted factor, and ECM regulator gene sets are shown for each subpopulation. Violin plots depict kernel density estimates of single cell values with the embedded boxplot showing the median (center line), the interquartile range (box limits) and whiskers extending to the minimum and maximum values. a,b, Heatmaps showing the inferred enrichment of transcription factor activity in each sub-AdECs subpopulation in the human SAT atlas independent of the metabolic state using pySCENIC in a and deCoupleR in b. c, Heatmap showing the inferred enrichment of transcription factor activity in each sub-AdECs subpopulation in the human SAT atlas across the three metabolic states; non-obese, obese, and obese diabetic. Transcription factors highlighted in red correspond to those discussed in the main text. a, Heatmaps depicting the differential number and strength of interactions in human SAT (in the two comparisons, Obese vs. Non-obese and Obese diabetic vs. Non-obese) with cell types clustered at a high granularity as inferred by CellChat. b, Heatmaps depicting the number of interactions in human SAT (in the three metabolic states; Non-obese, Obese, and Obese diabetic) with cell types clustered at a high granularity as inferred by LIANA+. c, Violin plots showing single-cell expression levels of FABP4 and CD74 across selected EC populations. Violin plots depict kernel density estimates of single cell values with the embedded boxplot showing the median (center line), the interquartile range (box limits) and whiskers extending to the minimum and maximum values. Statistical significance was assessed using a two-sided Kruskal–Wallis test, followed by Wilcoxon rank-sum tests for pairwise comparisons; exact P values are provided as Source Data. P < 0.05 was considered statistically significant. List of possible drugs for repurposing to target different cellular constituents of the human SAT vascular niche as identified using GREP. Primer sets used for mouse genotyping and RT–PCR. AAVS1 single-guide RNA (sgRNA) spacer and AAV6-AAVS1-SFFV-mCherry sequences. Statistical source data file for Supplementary Figs. Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law. AlZaim, I., Hassan, M.N., Schröter, M. et al. Defining the vascular niche of human adipose tissue across metabolic states. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Provided by the Springer Nature SharedIt content-sharing initiative Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology, drug discovery and pharma.
Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript. Nature Synthesis (2026)Cite this article 1,3-Oxazinanes are prized motifs found in bioactive heterocycles, but their synthesis is challenging owing to the lack of reliable methodologies. An unorthodox yet elegant approach to access 1,3-oxazinanes is to design a transformation that selectively inserts a carbon and nitrogen into readily available oxetane building blocks. However, despite progress in two-component skeletal expansions, the corresponding multicomponent reactions utilizing two distinct inserting entities remain elusive. Here we report that dual-atom insertion into oxetanes using various nitrogen and carbon sources can be achieved with a boron catalyst. The method streamlines the preparation of bioactive 1,3-oxazinanes and is amenable to late-stage editing to create multiheteroatom cyclic molecules. Mechanistic studies reveal a cascade pathway in which an in situ-generated frustrated Lewis pair enables ring deconstruction and reconstruction. This is a preview of subscription content, access via your institution Subscribe to this journal Receive 12 digital issues and online access to articles $119.00 per year only $9.92 per issue Buy this article Prices may be subject to local taxes which are calculated during checkout Crystallographic data have been deposited at the Cambridge Crystallographic Data Centre under reference nos. CCDC 2386484 (65), 2386485 (83) and 2386486 (21-(S)). Copies of the data can be obtained free of charge via https://www.ccdc.cam.ac.uk/structures/. All other data are available within the article and its Supplementary Information. Bull, J. A., Croft, R. A., Davis, O. A., Doran, R. & Morgan, K. F. Oxetanes: recent advances in synthesis, reactivity, and medicinal chemistry. Google Scholar Rojas, J. J. & Bull, J. A. Oxetanes in drug discovery campaigns. Google Scholar Wuitschik, G. et al. Spirocyclic oxetanes: synthesis and properties. Google Scholar Wuitschik, G. et al. Oxetanes in drug discovery: structural and synthetic insights. Google Scholar Zinad, D. S., Mahal, A., Mohapatra, R. K., Sarangi, A. K. & Pratama, M. R. F. Medicinal chemistry of oxazines as promising agents in drug discovery. Google Scholar Gupta, N. et al. 1,3-Oxazine as a promising scaffold for the development of biologically active lead molecules. Google Scholar Szász et al. HPLC investigation of a set of local anesthetic aminoether derivatives. Google Scholar Cahn, P. et al. Dolutegravir versus raltegravir in antiretroviral-experienced, integrase-inhibitor-naive adults with HIV: week 48 results from the randomised, double-blind, non-inferiority SAILING study. Google Scholar Benedini, F. et al. New antianginal nitro esters with reduced hypotensive activity. Synthesis and pharmacological evaluation of 3-[(nitrooxy)alkyl]-2H-1,3-benzoxazin-4(3H)-ones. Google Scholar Vanheusden, V. et al. Discovery of bicyclic thymidine analogues as selective and high-affinity inhibitors of mycobacterium tuberculosis thymidine monophosphate kinase. Google Scholar Eckstein, Z. & Urbański, T. 1,3-Oxazine derivatives. Google Scholar Holly, F. W. & Cope, A. C. Condensation products of aldehydes and ketones with o-aminobenzyl alcohol and o-hydroxybenzylamine. Google Scholar Barluenga, J., Tomás, M., Ballesteros, A. Simple synthesis of 2H-1,3-oxazines and their stereoselective transformation into 1,3-aminoalcohols and azetidines. Google Scholar Shen, G. et al. Synthesis of benzoxazine and 1,3-oxazine derivatives via ligand-free copper(I)-catalyzed one-pot cascade addition/cyclization reaction. Google Scholar Jurczyk, J. et al. Single-atom logic for heterocycle editing. Google Scholar Joynson, B. W. & Ball, L. T. Skeletal editing: interconversion of arenes and heteroarenes. Google Scholar Donald, J. R. & Unsworth, W. P. Ring-expansion reactions in the synthesis of macrocycles and medium-sized rings. Google Scholar Hui, C., Wang, Z., Wang, S. & Xu, C. Molecular editing in natural product synthesis. Google Scholar Lyu, H., Kevlishvili, I., Yu, X., Liu, P. & Dong, G. Boron insertion into alkyl ether bonds via zinc/nickel tandem catalysis. Google Scholar Zhang, X. et al. N-Heterocycle-editing to access fused-BN-heterocycles via ring-opening/C−H borylation/reductive C−B bond formation. Google Scholar Wang, Z., Jiang, L., Sarró, P. & Suero, M. G. Catalytic cleavage of C(sp2)−C(sp2) bonds with Rh-carbynoids. Google Scholar Dherange, B. D., Kelly, P. Q., Liles, J. P., Sigman, M. S. & Levin, M. D. Carbon atom insertion into pyrroles and indoles promoted by chlorodiazirines. Google Scholar Wang, K. et al. Asymmetric catalytic ring-expansion of 3-methyleneazetidines with α-diazo pyrazoamides towards proline-derivatives. Google Scholar Wu, F.-P. et al. Ring expansion of indene by photoredox-enabled functionalized carbon-atom insertion. Google Scholar Liu, S. et al. Tunable molecular editing of indoles with fluoroalkyl carbenes. Article PubMed Google Scholar Reisenbauer, J. C., Green, O., Franchino, A., Finkelstein, P. & Morandi, B. Late-stage diversification of indole skeletons through nitrogen atom insertion. Google Scholar Wang, J., Lu, H., He, Y., Jing, C. & Wei, H. Cobalt-catalyzed nitrogen atom insertion in arylcycloalkenes. Google Scholar Kelly, P. Q., Filatov, A. S. & Levin, M. D. A synthetic cycle for heteroarene synthesis by nitride insertion. Google Scholar Boudry, E., Bourdreux, F., Marrot, J., Moreau, X. & Ghiazza, C. Dearomatization of pyridines: photochemical skeletal enlargement for the synthesis of 1,2-diazepines. Google Scholar Siddiqi, Z., Wertjes, W. C. & Sarlah, D. Chemical equivalent of arene monooxygenases: dearomative synthesis of arene oxides and oxepines. Google Scholar Siddiqi, Z. et al. Oxidative dearomatization of pyridines. Google Scholar Xue, Y. & Dong, G. Deconstructive synthesis of bridged and fused rings via transition-metal-catalyzed ‘cut-and-sew' reactions of benzocyclobutenones and cyclobutanones. Google Scholar Shiratori, Y., Jiang, J., Kubota, K., Maeda, S. & Ito, H. Ring expansion of cyclic boronates via oxyboration of arynes. Google Scholar Wang, H. et al. Dearomative ring expansion of thiophenes by bicyclobutane insertion. Google Scholar Stephan, D. W. The broadening reach of frustrated Lewis pair chemistry. Article PubMed Google Scholar Stephan, D. W. Frustrated Lewis pairs: from concept to catalysis. Google Scholar Kamitani, M. et al. Single-carbon atom transfer to α,β-unsaturated amides from N-heterocyclic carbenes. Google Scholar Woo, J., Stein, C., Christian, A. H. & Levin, M. D. Carbon-to-nitrogen single-atom transmutation of azaarenes. Google Scholar Uhlenbruck, B. J. H., Josephitis, C. M., de Lescure, L., Paton, R. S. & McNally, A. A deconstruction–reconstruction strategy for pyrimidine diversification. Google Scholar & Bregadze, V. I. Lewis acidity of boron compounds. Google Scholar Chen, R. et al. A three-component reaction to construct β-aminonitroso-α-diazocarbonyl compounds under metal-free conditions. Google Scholar Geier, S. J. & Stephan, D. W. Lutidine/B(C6F5)3: at the boundary of classical and frustrated Lewis pair reactivity. Google Scholar Zhang, Z., Miao, C., Xia, C. & Sun, W. Synergistic acid-catalyzed synthesis of N‑aryl-substituted azacycles from anilines and cyclic ethers. Google Scholar Guru, M. M., De, S., Dutta, S., Koley, D. & Maji, B. B(C6F5)3-catalyzed dehydrogenative cyclization of N-tosylhydrazones and anilines via a Lewis adduct: a combined experimental and computational investigation. Google Scholar Khan, Md. N. et al. Advances in CO2 activation by frustrated Lewis pairs: from stoichiometric to catalytic reactions. Google Scholar Hwang, J. Y. et al. Synthesis and evaluation of hexahydropyrimidines and diamines as novel hepatitis C virus inhibitors. Google Scholar Glasovac, Z., Eckert-Maksić, M. & Maksić, Z. B. Basicity of organic bases and superbases in acetonitrile by the polarized continuum model and DFT calculations. New J. Chem. Google Scholar Kolb, H. C., Finn, M. G. & Sharpless, K. B. Click chemistry: diverse chemical function from a few good reactions. Google Scholar Gucma, M., Gołębiewski, W. M. & Krawczyk, M. Application of chiral ligands: carbohydrates, nucleoside-lanthanides and other Lewis acid complexes to control regio- and stereoselectivity of the dipolar cycloaddition reactions of nitrile oxides and esters. Google Scholar Stanton, M. et al. Biaryl amide and heteroaryl amides for treatment of Candida albicans infection. Zhang, M. et al. Preparation of aza-heterocyclic compounds as WWP1 inhibitors and used for treatment of cancer. Chinese patent CN115703761A (2023). Yang, C., Lin, M., Cheng, S. & Feng, Y. Pharmaceutical compositions comprising benzenesulfonamide derivatives and pharmaceutically acceptable carriers for treating mast cell tumors. Franchi, L. et al. The compounds and compositions for treating conditions associated with NLRP activity. Kronenthal, D. R., Han, C. Y. & Taylor, M. K. Oxidative N-dearylation of 2-azetidinones. p-Anisidine as a source of azetidinone nitrogen. Google Scholar Konetuzki, I. et al. Novel 2,5-substituted pyrimidines as PDE inhibitors and their preparation. This research was supported by the Ministry of Education of Singapore Academic Research Fund Tier 1 (grant no. A-8001693-00-00) and National Research Foundation, Prime Minister's Office, Singapore under the NRF Investigatorship programme (grant no. I. I. Roslan (National University of Singapore) assisted with X-ray crystallographic measurements. Department of Chemistry, National University of Singapore, Singapore, Republic of Singapore Ying-Qi Zhang, Shuo-Han Li & Ming Joo Koh Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar conceived of the work. conducted the optimization, reaction scope and mechanistic studies. directed the research. All authors contributed to the writing of the paper. Correspondence to Ming Joo Koh. The authors declare no competing interests. Nature Synthesis thanks Melissa Ramirez and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Primary Handling Editor: Peter Seavill, in collaboration with the Nature Synthesis team. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. 1–12 and Tables 1–6 and experimental details. Single-crystal X-ray diffraction data for compound 21-(S) (CCDC 2386486). Single-crystal X-ray diffraction data for compound 65 (CCDC 2386484). Single-crystal X-ray diffraction data for compound 83 (CCDC 2386485). Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law. Reprints and permissions Zhang, YQ., Li, SH. & Koh, M.J. Heteronuclear dual-atom insertion into oxetanes via frustrated Lewis pair activation. Received: 07 February 2025 Accepted: 18 February 2026 Version of record: 12 March 2026 DOI: https://doi.org/10.1038/s44160-026-01031-6 Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Provided by the Springer Nature SharedIt content-sharing initiative Nature Synthesis © 2026 Springer Nature Limited Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.
After analyzing 385 studies related to coastal areas and sea level rise, scientists found a significant discrepancy between geoid measurements and actual sea levels, especially in the global south. We may earn commission if you buy from a link. Science is only as good as the foundation of data it's built upon, and a new study from researchers at Wageningen University in the Netherlands suggests that estimates of future sea level rise may have been worryingly underestimated. But the new data snafu stems instead from an inconsistency between how we measure sea levels in science research broadly. Geoids are handy mathematical models that calculate global mean sea level based on gravity and Earth's rotation. Because Earth isn't a perfect sphere, these models help scientists accurately calculate sea level when conducting science along coastal areas—or at least, that's what we thought. A new study published in the journal Nature took a closer look at that assumption by analyzing hundreds of scientific research publications that used geoid models while conducting research along coastlines around the world. One of the big limitations of geoid models is that they assume a calm ocean, which effectively underrepresents important dynamics like winds, tides, and currents. In Northern Europe and the United States—where seas are generally calmer and scientists have more data sources for sea level rise—these discrepancies are minuscule, but in other parts of the world like Southeast Asia and the Indo-Pacific, the gap between assumed sea levels and real sea levels is cause for concern. “Researchers who study land elevation or sea levels try to make their elevation models as accurate as possible,” Wageningen University's Philip Minderhoud, who co-authored the study with his colleague Katharina Seeger, said in a press statement. “Most researchers […] seem to be unaware that it is necessary to use and correctly align measurements of both land and the sea when performing coastal impact assessments.” Minderhoud first became suspicious of geoid model accuracy while conducting research in Vietnam's Mekong Delta in 2015, after discovering that the delta (one of the largest in the world) was surprisingly lower than geoid models suggest. He published these findings in the journal Nature Communications in 2019, writing at the time that “our results imply major uncertainties in sea-level rise impact assessments for the Mekong delta and deltas worldwide, with errors potentially larger than a century of sea-level rise.” That instinct proved correct, as Seeger similarly found inaccuracies while conducting her Ph.D. research along the Ayeyarwady Delta in Myanmar. While such systematic mismeasurement has potentially disastrous implications for these watery delta regions, the study also found that the reverse can be true—sea levels in Antarctica, for example, are lower than scientists assumed. “That is how science works,' Minderhoud said in a press statement. “Now that we have discovered this blind spot, the scientific community can make more accurate assessments for coastal areas and cities around the world.” Earth Will Lose Its Gravity, Says This Wild Theory
You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript. Tissue clearing has been widely used for fluorescence imaging of fixed tissues, but its application to live tissues has been limited by toxicity. Here we develop minimally invasive optical clearing media for fluorescence imaging of live mammalian tissues. Light scattering is minimized by adding spherical polymers with low osmolarity to the extracellular medium. A clearing medium containing bovine serum albumin (SeeDB-Live) is compatible with live cells, enabling structural and functional imaging of live tissues, such as spheroids, organoids, acute brain slices and the mouse brains in vivo. SeeDB-Live minimally affects neuronal electrophysiological properties and sensory responses in vivo, and facilitates fluorescence imaging of deep cortical layers in live animals without detectable toxicity to neurons or behavior. We further demonstrate its utility to epifluorescence voltage imaging in acute brain slices and in vivo preparations. Thus, SeeDB-Live expands both the depth and modality range of fluorescence imaging in live mammalian tissues. Live biological tissues are dynamic by nature. Thanks to various chemical and genetically encoded fluorescent biosensors, we can image and measure dynamic biological phenomena within the live tissues and organs using fluorescence microscopy. However, the imaging depth is often limited by tissue opacity. It has been a long-standing challenge to make live and healthy biological tissues transparent to facilitate live imaging. Two-photon microscopy uses a near-infrared excitation laser instead of visible light to reduce light scattering; however, the imaging depth is limited to a few hundred microns in mammalian tissues in vivo1. Adaptive optics uses a deformable mirror or spatial light modulator to correct aberrations caused by macroscopic refractive index distortions, but it is not effective for highly scattering samples2. For fixed tissues, optical clearing is a powerful approach: light refraction and scattering are minimized by removing high-index components (for example, lipids) and/or by immersing the sample in high-index solutions with refractive indices of 1.43–1.55 (refs. However, most of the clearing agents developed for fixed tissues are toxic to live cells. Less toxic chemicals (for example, glycerol, dimethyl sulfoxide and sugars) have been tested for highly fibrous extracellular structures, such as skin and skull in vivo14,15,16,17,18,19; however, these chemicals interfere with cellular functions. A recent study claimed to have achieved optical clearing of the skin in live animals using a strongly absorbing dye, such as tartrazine18. Therefore, live mammalian cells and tissues have not yet been rendered transparent while maintaining intact cellular functions. Some chemicals have been proposed to be compatible with live cell imaging. Iodinated contrast agents were attractive candidates because of their low osmolarity. However, its toxicity to mammalian cells has not been fully evaluated. Another study attempted to improve transparency of the mouse brain by adding glycerol to drinking water22. However, it is unclear whether the marginal change in transparency was due to an increase in the refractive index in the brain, as glycerol should be easily metabolized once absorbed in the gut. Here we developed SeeDB-Live, a tissue-clearing medium for live mammalian cells and tissues. SeeDB-Live contains bovine serum albumin (BSA), which has exceptionally low osmolarity when dissolved in water and is minimally invasive to live cells. SeeDB-Live improved the imaging depth of spheroids, organoids, acute brain slices and the mouse brain in vivo. Light scattering in tissues is caused by refractive index mismatch between the light scatterer and the medium. Previously, simple immersion-based clearing agents (refractive index, 1.46–1.52) have been developed (for example, fructose, iohexol and tartrazine)8,9,18; however, osmolarity of these clearing agents is extremely high. To make live tissues transparent under isotonic conditions, we would have to use either (i) membrane-permeable or (ii) membrane-impermeable low-osmolarity (that is, high molecular weight) chemicals to reduce the refractive index mismatch (Fig. We have listed membrane-permeable and membrane-impermeable high-molecular-weight chemicals as candidates. Candidate chemicals also need to be highly soluble in water. These chemicals demonstrated a concentration-dependent increase in refractive index when dissolved in water (Extended Data Fig. a, Strategies for optical clearing of live cells. b, Transmittance (at 600 nm) of HeLa cell suspension (4 × 106 cells per ml) in isotonic saline solution with glycerol or iodixanol at different refractive indices. Fixed cells were treated with PFA and saponin. c, Calcium imaging of GCaMP6f-expressing HEK293T cells stimulated with 50 μM ATP. Osmolarity was not adjusted to isotonicity. Data are the median ± interquartile range (IQR). d, The osmolality of candidate chemicals in aqueous solution (refractive index 1.365, in double-distilled water (ddH2O; n = 3 each). Sucrose was used as a control. The osmolality of low-salt BSA (2) was 2.7 mOsm kg−1, consistent with its molar concentration (2.3 mM). e, The optimal refractive index of the extracellular medium was determined in PBS adjusted at different osmolalities. Transmittance of live HeLa cell suspensions (4 × 106 cells per ml) was measured. Left: optimal refractive index (1.369) of iodixanol-containing PBS. Right: optimal refractive index (1.363–1.369) of BSA-containing PBS (n = 3 each). f, Phase contrast images of live HeLa cells in normal and BSA-containing medium (refractive index, 1.363). g, Proliferation curve of HeLa/Fucci2 cells in iodixanol, Ficoll70 and BSA#1-containing medium (refractive index, 1.363; 320 mOsm kg−1). P values are <0.001 unless otherwise mentioned. h, Growth ratio in refractive index-optimized (refractive index, 1.363; 320 mOsm kg−1) medium compared to the control medium. P values are <0.001 unless otherwise mentioned. i, Phase contrast images of HeLa/Fucci2 cell spheroids under normal (left) and SeeDB-Live culture medium (refractive index 1.366, 320 mOsm kg−1; right). j, Growth curve of HeLa/Fucci2 cell spheroids with and without treatment with SeeDB-Live for 4 h per day. NS (P ≥ 0.05; two-sided Wilcoxon rank-sum test combined with Holm–Bonferroni correction). k, Three-dimensional (3D) confocal images of a HeLa/Fucci2 cell spheroid. l,m, Intestinal organoids in Matrigel treated with SeeDB-Live (refractive index, 1.363) for 4 h per day. m, Growth of the intestinal organoids. NS (P ≥ 0.05; two-sided Wilcoxon rank-sum test combined with Holm–Bonferroni correction). n, 3D confocal images of GCaMP6s-expressing EECs in intestinal organoids from ePet-Cre; Ai162 mice before and after SeeDB-Live treatment. o,p, Calcium imaging of cortical organoids (confocal). Basal fluorescence (temporal median; left) and ΔF/F0 images (right) of a cortical organoid labeled with a calcium indicator, Calblyte-650AM (o). Spontaneous calcium transients of neurons (p). Data with error bars represent the mean ± s.d. See Supplementary Table 4 for detailed statistical data. MW, molecular weight; PG, propylene glycol; PEG, polyethylene glycol; HBCD, hyperbranched cyclic dextrin; PVP, polyvinyl pyrrolidone. Next, we sought to determine the optimal refractive index for clearing live mammalian cells. For this purpose, we prepared a suspension of live or paraformaldehyde (PFA)-fixed and membrane-permeabilized HeLa cells (4 × 106 cells per ml). The refractive indices of media used to clear fixed tissues are typically 1.43–1.55 (ref. We tested a membrane-permeable chemical, glycerol, up to a refractive index of 1.43 (~66% wt/vol); however, it was not effective for live mammalian cells (Fig. We also tested a membrane-impermeable chemical, iodixanol; to keep the osmolarity of the buffer isotonic, we mixed isotonic iodixanol solution (60% wt/vol) and phosphate buffered saline (PBS) to prepare isotonic solutions with different refractive indices. PFA-fixed and membrane-permeabilized HeLa cells were most transparent at a refractive index of ~1.42. Paradoxically, however, we found that the live HeLa cells become most transparent at an extracellular refractive index of ~1.37, much lower than the optimal index for fixed cells (Fig. Moreover, the optimal range of the refractive index for live cells was relatively narrow; the transparency of live cells became lower at higher refractive indices (>1.38). We next examined whether intracellular functions remain intact in the presence of candidate chemicals. Using the GCaMP6f calcium indicator, we evaluated the calcium responses of HEK293T cells to 50 μM ATP solution under various clearing media at a refractive index of 1.365 (Fig. Calcium responses were completely abolished in the presence of membrane-permeable chemicals, glycerol (23% wt/vol), dimethyl sulfoxide (DMSO) and propylene glycol, while a lower concentration of glycerol (5%) showed weak responses. These results indicate that membrane-permeable clearing agents impair cellular functions at a refractive index of 1.365. Among the membrane-impermeable, high-molecular-weight chemicals, straight polymers abolished calcium responses (for example, polyethylene glycol and polyvinyl pyrrolidone). These results indicate that some of the membrane-impermeable, high-molecular-weight chemicals could be useful for index matching of the extracellular medium without compromising cellular functions. Membrane-impermeable chemicals will not directly interfere with intracellular functions but may increase osmolarity. Therefore, the ideal chemical should have a low osmolarity when dissolved in water to achieve the optimal refractive index. The increase in osmolarity can be minimized if we use high-molecular-weight chemicals (>1 kDa); however, extremely large particles (>10-nm scale) will cause Rayleigh scattering. Straight-chain polymers had prohibitively high osmolalities, much higher than the theoretical values based on molar concentrations23; the higher osmolality may explain why straight-chain polymers showed cellular toxicity (Fig. In contrast, we found that spherical polymers (polymers with highly branched and/or higher-order structures) have much lower osmolalities (Fig. Among them, low-salt BSA (BSA#2) demonstrated exceptionally low osmolality of only 2.7 mOsm kg−1, consistent with its molar concentration (2.3 mM; Fig. Slightly higher osmolarity for another BSA product (BSA#1) was due to residual salts in the product (Extended Data Fig. 1e), suggesting that BSA itself has very low osmolality. The osmolarity of the saline buffers and culture media for mammalian cells is 230–340 mOsm l−1, but is typically 300–330 mOsm l−1. For both iodixanol (control) and BSA, we further refined the optimal refractive index for this range. The best refractive index was higher at higher extracellular osmolarity, likely because the cytosol is more condensed. When live HeLa cells were incubated with BSA-containing medium (refractive index, 1.363), the plasma membrane was almost invisible under the phase contrast microscopy (Fig. Cell growth was monitored for up to 3 days. Cell growth was comparable to the control DMEM for one of the BSA products (BSA#1; Fig. However, cell growth was lower for iodixanol, highly branched cyclic dextrin, Ficoll70 and some of the BSA products (Fig. BSA is also preferable in terms of lower viscosity (Extended Data Fig. 1j,k) and specific gravity (Extended Data Fig. Other proteins may be similarly useful; however, BSA has exceptional water solubility and is one of the most affordable proteins available. In addition, albumin is the most abundant protein in the serum (4–5% wt/vol) and has been widely used for mammalian cell culture, suggesting that BSA is minimally adverse to the mammalian cells. Albumin buffers divalent cations (for example, Ca2+ and Mg2+)24,25. Earlier biochemical studies indicated that a half of Ca2+ and Mg2+ binds to BSA in this condition, consistent with our results24,26. Primary cultures of mouse cardiomyocytes (Extended Data Fig. 3a–c) and hippocampal neurons (Extended Data Fig. 3d–g) were maintained in the BSA-containing culture medium for at least 3 days without any obvious signs of toxicity. In this way, we established BSA-containing clearing media (15–17% wt/vol) for live mammalian cells, named SeeDB-Live, with optimal refractive index (1.363–1.366), osmolality (230–340 mOsm kg−1) and total Ca2+ and Mg2+ concentrations (4–6 mM and 1.5–2.5 mM, respectively) with saline or culture medium (Supplementary Tables 1 and 2). Recently, strongly absorbing dyes (for example, tartrazine and ampyrone) have been shown to clear the mouse skin18,27, but they work only under prohibitively high osmolality conditions. Under physiological osmolality conditions (~300 mOsm kg−1), they have lower refractive indices and cannot effectively clear live cells (Fig. Another recent study increased refractive index of the extracellular media by only 0.01 using polymer solutions (6% polyethylene glycol (PEG) and 4% dextran)28; however, the refractive index of 1.34–1.35 was far below the optimal range for live mammalian cells (Fig. Thus, SeeDB-Live is currently the only method that achieves optical transparency of live, healthy mammalian cells. We examined whether SeeDB-Live is useful for fluorescence imaging of multicellular structures. We cleared cultured HeLa/Fucci2 cell spheroids29 with SeeDB-Live; the spheroids became quickly transparent without apparent shrinkage or expansion under SeeDB-Live (Fig. Growth of HeLa/Fucci2 spheroids was slightly slower when continuously cultured in SeeDB-Live, possibly due to lower circulation of oxygen (Extended Data Fig. However, daily clearing with SeeDB-Live for 4 h per day did not affect the growth of the spheroid culture (Fig. Next, we tested SeeDB-Live for imaging intestinal organoids cultured in Matrigel. Intestinal organoids were developed from ePet-Cre; Ai162 mice, in which enteroendocrine cells (EECs) express a calcium indicator, GCaMP6s. 1l), and the organoid growth was not affected by daily 4-h clearing with SeeDB-Live (Fig. Nonetheless, the GCaMP6s-positive EECs were visible in deeper areas under SeeDB-Live using confocal microscopy (Fig. Calcium imaging demonstrated robust responses to high potassium stimulation, indicating that their physiological functions are maintained (Extended Data Fig. We also tested SeeDB-Live for confocal calcium imaging of the neuroepithelial and cortical organoids induced from mouse embryonic stem cells (Fig. Thus, SeeDB-Live will be useful for functional assays of organoids. Together, our results indicate that the light scattering in live cells can be greatly reduced by index matching between the cytosol (1.363–1.366) and the extracellular medium. Index matching of the extracellular medium with isotonic medium with BSA (SeeDB-Live) is minimally invasive and powerful for optical clearing of live mammalian tissue (Fig. Volume imaging is in high demand for neuroscience applications. Perfusion with SeeDB-Live/ACSF cleared acute brain slices within 30 min (Fig. We evaluated the performance of SeeDB-Live using acute brain slices from Thy1-YFP-H mice. After the recovery of acute brain slices in oxygenated ACSF, confocal and two-photon images were acquired. The imaging depth was increased ~2-fold for both confocal and two-photon microscopy under SeeDB-Live (Fig. Similar results were obtained for the hippocampus (Extended Data Fig. The optimal refractive index of SeeDB-Live was ~1.363 in acute brain slices (Extended Data Fig. 5d), consistent with our results for cultured cell data (Fig. We did not observe improved transparency with 5% glycerol ex vivo, contrary to a previous report in vivo (Extended Data Fig. a, Preparation of acute brain slices and clearing with SeeDB-Live. Acute brain slices were perfused with SeeDB-Live/ACSF (refractive index, 1.363; 320 mOsm kg−1 in ACSF) at a flow rate of 1.5 ml min−1 in a chamber. 15.6% (vol/vol) 2,2′-thiodiethanol (TDE) in ddH2O (refractive index, 1.363) was used for immersion to minimize spherical aberration. b,c, An acute brain slice (300-μm thick; age, postnatal day 5 (P5); bright-field images) before (b) and after (c) clearing with SeeDB-Live/ACSF. Confocal one-photon (1P) and two-photon (2P) images are shown. Right: normalized fluorescence intensity from cell bodies in x–y fluorescence images of S1 L5ET neurons are shown on the right for each depth. The same sets of neurons were compared before and after clearing. f, Two-photon shadow images in S1 L5 region of acute brain slices (age P18, 300-μm thick). Imaging was performed before and after clearing with SeeDB-Live/ACSF. g, Shadow images (left) and their magnified views (right) in the intermediate (100–115-μm stack) and deeper (185–200-μm stack) regions (inverse look-up table images). Note that the brightness and contrast were adjusted for each image because fluorescence intensities differed across the conditions. h, Line plots showing the raw fluorescence intensity along the orange dashed line in g under control and SeeDB-Live. i, Magnified views of the shadow images showing dense nerve fibers. Data from representative samples of ≥3 trials are shown. See Supplementary Table 4 for detailed statistical data. Previously, shadow imaging of organotypic brain slice cultures with super-resolution, confocal and two-photon microscopy have been proposed for comprehensive structural imaging of the brain, including dense connectomics applications32,33,34; in these techniques, the extracellular space of the brain slices is labeled with a dye solution (for example, calcein). However, the surface of the brain slices (~50 μm) is often mechanically damaged during slice preparation (Extended Data Fig. 5e), making it difficult to image ‘acute' brain slices that represent native in vivo structure. Using SeeDB-Live, the imaging depth possible for the shadow imaging was much improved with two-photon microscopy (Fig. Inverse look-up table images demonstrated morphology of all the cells at higher signal-to-noise ratio under SeeDB-Live (Fig. Thus, SeeDB-Live facilitates comprehensive structural imaging of acute brain slices. For comprehensive recording of neuronal activity with SeeDB-Live, it is important to ensure that neuronal functions remain intact. Using acute mouse brain slices (age, P15–18), we examined membrane properties of layer 5 extratelencephalic-projecting (L5ET) neurons using patch-clamp recording (Fig. Some of the electrophysiological parameters were slightly affected (Fig. However, the firing properties in the frequency–current curve were not affected, possibly because differences in some factors counteracted each other (Fig. We obtained consistent results in older animals (Extended Data Fig. 6f,g) and for fast-spiking interneurons (Extended Data Fig. Samples were analyzed at the same time point after preparation. b, Resting membrane potential, action potential (AP) threshold, AP amplitude and input resistance are shown. n = 17 neurons from four mice and 14 neurons from three mice for control and SeeDB-Live, respectively. c, AP frequency was plotted against injected current amplitude. d,e, Spontaneous currents at the holding potential of −60 mV. Representative traces (d), amplitude and frequency of spontaneous excitatory postsynaptic currents (sEPSCs; e) are shown. f–n, Spontaneous and evoked responses of mitral cells in the olfactory bulb (OB) cleared with SeeDB-Live and imaged with two-photon microscopy. f, GCaMP6f fluorescence images (temporal median) of mitral cells in acute OB slices (age, P11) imaged with two-photon microscopy. Traces for representative neurons (arrows) are shown. Spontaneous activity was imaged before (left), during (middle) and after (right) clearing with SeeDB-Live/ACSF at a depth of 100 μm from the surface of the slice. g,h, Amplitude and frequency of spontaneous activity in the same set of mitral cells in ACSF and SeeDB-Live/ACSF. n = 18 cells from three mice (age, P11–14). NS (multiple comparisons with Bonferroni correction). i–k, 100 μM NMDA and 40 μM glycine (Gly) were applied to the OB slices (Thy1-GCaMP6f, age P15) for 1.5 min. (j) and response amplitudes (k) are shown. The slower decay of the response may be due to slower washout of NMDA/glycine under SeeDB-Live. l–n, Acute OB slices (age, P9–11) were imaged with two-photon microscopy at a depth of 150 μm. l, Basal fluorescence (temporal median) of GCaMP6f and ΔF/F0 images are shown for different time points. Basal fluorescence intensity (m) and ΔF/F0 (n) of mitral cell somata during clearing with SeeDB-Live/ACSF are shown. o, Confocal images of acute OB slices (Thy1-GCaMP6f mouse, age P13) under control and SeeDB-Live conditions. The images of temporal median are shown. Box plots indicate the median ± IQR. See Supplementary Table 4 for detailed statistical data. Patch-clamp recording under SeeDB-Live was extremely difficult because brain slices were almost transparent. We cannot exclude the possibility that unintentional sampling bias has contributed to the difference. It should also be noted that the ionic composition of SeeDB-Live is not identical to that of the control ACSF. The total amount of Ca2+ and Mg2+ is adjusted higher (Extended Data Fig. Cl− concentration is slightly lower because BSA substantially contributed to the net negative charge (Extended Data Fig. BSA may also show the Donnan effect. These factors potentially affect the electrophysiological properties, and further optimization might be needed for more specific experiments. We next evaluated population-level properties of neurons using slice calcium imaging. We used olfactory bulb slices (P11–15), in which mitral/tufted cells show spontaneous activity35. We used Thy1-GCaMP6f mice, in which mitral/tufted cells express GCaMP6f. We imaged mitral cells with two-photon microscopy at a depth of ~100 μm. The frequencies of spontaneous activity were not significantly different between control and SeeDB-Live when Ca2+/Mg2+ concentrations were optimized (Fig. In contrast, spontaneous activity was no longer maintained in the glycerol or iodixanol-containing ACSF (Extended Data Fig. Evoked responses (to 100 μM N-methyl-D-aspartate (NMDA) and 40 μM glycine) of mitral cells were also comparable between control and SeeDB-Live (Fig. Time-lapse imaging of a deeper area (150-μm depth) demonstrated a significant improvement in brightness and ΔF/F0 by SeeDB-Live/ACSF treatment (Fig. Notably, spontaneous activity of mitral cells was clearly visible with one-photon confocal microscopy at a depth of 100 μm under SeeDB-Live, but not with control ACSF (Fig. It should be noted that the superficial ~50 μm of acute brain slices is typically damaged during sample preparation, and intact neuronal activity is only visible in deeper areas, where only two-photon microscopy can access under the normal ACSF. Thus, SeeDB-Live enables calcium imaging of healthy neuronal activity in acute brain slices using conventional confocal microscopy, without using two-photon microscopy systems. SeeDB-Live is based on index matching with a membrane-impermeable molecule, BSA. To clear the mouse brain in vivo in live animals, we performed a craniotomy at the primary somatosensory cortex (S1) and removed the dura mater (durotomy) under anesthesia. We confirmed that fluorescently tagged BSA was infused to a depth of ~500 μm from the surface of the cerebral cortex (Fig. We used a transgenic line, Thy-YFP-H, in which L5ET neurons are labeled with EYFP. Under two-photon microscopy, overall brightness of EYFP signals was increased in the deeper area after incubation with SeeDB-Live for 1 h (Fig. Their basal dendrites, including dendritic spines, were better visualized with SeeDB-Live (Fig. The brightness of L5ET somata, located at a depth of 600–800 μm, was increased ~3-fold by SeeDB-Live treatment (Fig. The cleared part returned opaque once SeeDB-Live is diluted by the CSF circulation and/or by active washout with ACSF (Fig. Thus, SeeDB-Live is a powerful tool for in vivo imaging of live neurons in the brain. a–k, Optical clearing and fluorescence imaging of the cortex in live mice under anesthesia. a, Schematic diagram of surgery and clearing of the mouse cortex with SeeDB-Live/ACSF-HEPES (refractive index, 1.363; 300 mOsm kg−1). Craniotomy and durotomy were made on the right hemisphere. The objective lens was directly immersed in SeeDB-Live/ACSF-HEPES. b,c, The diffusion of fluorescently labeled BSA (1% BSA-CF597 dissolved in SeeDB-Live) into the cortex in anesthetized mice (age, 2–4 months). Frozen sections of non-perfused and unfixed brains were analyzed (b). The relative fluorescence intensity across cortical depth is shown (c). d–k, S1 of a Thy1-EYFP-H mouse was imaged before and after clearing with SeeDB-Live/ACSF-HEPES (1 h after clearing) with two-photon microscopy. d, 3D-rendered images of L5ET neurons (Thy1-YFP-H; age, 6 months). Laser power and photomultiplier tube gain were kept constant across the depths. f, Fluorescence intensity at different depths. g,h, Somata and basal dendrites of L5ET neurons (age, 4 months). Basal dendrites and their dendritic spines could only be clearly visualized after clearing with SeeDB-Live/ACSF-HEPES. k, S1 L5ET neurons of a 4-month-old Thy1-EYFP-H mouse were imaged using two-photon microscopy before, during and after 1 h of clearing with SeeDB-Live/ACSF-HEPES. l, A large cranial window encompassing motor and somatosensory areas was made for the right hemisphere. After craniotomy and durotomy, an optical window was made using a PVDC wrapping film, silicone sealant and a coverslip (center; day −7). SeeDB-Live treatment was performed 7 days after the initial surgery (day 0). The cranial window was replaced with a new one after SeeDB-Live/ACSF-HEPES treatment at day 0 for chronic behavioral assays (n–p). m, Mouse locomotor activity on a treadmill was measured for 10 min during clearing with SeeDB-Live/ACSF-HEPES in head-fixed awake animals. The total distance traveled and the maximum speed of mice treated with control ACSF-HEPES and SeeDB-Live/ACSF-HEPES were compared. Total distances traveled by mice in an open chamber at 1, 4 and 7 days after treatment with control ACSF-HEPES and SeeDB-Live/ACSF-HEPES are shown. NS (P ≥ 0.05; two-sided Wilcoxon rank-sum test). o, Motor function was examined with the wire hanging test55. Fall time of mice in the wire hanging test at 1, 4 and 7 days after treatment with ACSF-HEPES, Rose Bengal and SeeDB-Live/ACSF-HEPES. p, Food consumption of mice treated with control ACSF-HEPES, unilateral ischemia and SeeDB-Live/ACSF-HEPES. Images show representatives of ≥2 trials except for k (single trial). See Supplementary Table 4 for detailed statistical data. Panels a and m created in BioRender. We examined possible toxicity of SeeDB-Live in vivo using a large cranial window on the right cortical surface (Fig. Acute SeeDB-Live treatment of the right cortex, including motor cortices, in awake animals did not affect locomotor activity on a treadmill (Fig. Moreover, SeeDB-Live treatment did not affect locomotor activity, motor function (wire hanging test) and food intake on consecutive days (Fig. We observed no obvious sign of the inflammatory responses in the brain (for example, the number and morphology of neurons and microglia) after clearing with SeeDB-Live (Extended Data Fig. Thus, SeeDB-Live treatment does not induce acute or chronic toxicity in animals. Next, we investigated whether sensory responses are preserved after SeeDB-Live treatment in vivo. We performed a durotomy in the primary visual cortex (V1) and compared the visual responses of layer 4 neurons before and after SeeDB-Live treatment (Fig. 5a), assuming that layer 4 is adequately infused with SeeDB-Live (Fig. Using calcium indicators jGCaMP8m and Cal-520, we recorded the calcium responses of the same sets of neurons to visual grating stimuli of different orientations under anesthesia (Fig. We found that the preferred orientation, response amplitude (ΔF/F0), orientation selective index (OSI) and tuning width of layer 4 neurons were largely preserved (Fig. Thus, SeeDB-Live preserves physiological sensory responses. a–e, Two-photon calcium imaging of L4 neurons expressing jGCaMP8m (AAV-DJ-Syn-jGCaMP8m-WPRE) in V1 before and after clearing with SeeDB-Live/ACSF-HEPES. Drifting gratings of various orientations were presented to anesthetized mice. b, Basal fluorescence of jGCaMP8m without visual stimulation. L4 neurons at a depth of 435 μm. c,d, Responses of a representative L4 neuron (indicated by arrowheads in b) to visual grating stimuli before and after clearing with SeeDB-Live/ACSF-HEPES (c). e, Preferred orientation, maximum responses (ΔF/F0), OSI and tuning width (Sigma) for the same set of L4 neurons (136 neurons from three mice) before (x axis) and after (y axis) clearing with SeeDB-Live/ACSF-HEPES. The comparison was performed as described previously56. f, x–y images of mitral cells in the olfactory bulb of a Thy1-GCaMP6f mouse (4-month-old, anesthetized) was imaged before and after clearing with SeeDB-Live/ACSF-HEPES (1 h after clearing) with two-photon microscopy. g, Odor responses of mitral cells upon 1% valeraldehyde. The odor was delivered to a mouse nose for 5 s at 1 l min−1. Arrows indicate the same sets of neurons. h, Representative excitatory/inhibitory responses of mitral cells indicated in g. i–p, Chronic imaging in awake animals using repeated SeeDB-Live treatment. j, After clearing with SeeDB-Live/ACSF-HEPES for 1 h, the brain surface was covered with the PVDC film. Between the film and the glass coverslip, 1.5% (wt/vol) agarose was applied with and without 19.3% (wt/vol) glycerol (refractive index, 1.363) for the SeeDB-Live and control conditions, respectively. For objective lens immersion, 15.6% (vol/vol) TDE/ddH2O (refractive index, 1.363) and ddH2O were used for SeeDB-Live and the control, respectively. Imaging was performed within 1 h after SeeDB-Live treatment. k, Basal fluorescence (temporal median) of jGCaMP8m-expressing L5 neurons at day 0. m, Representative Ca2+ responses of L5 neurons indicated in k and l during repeated whisker stimulations with air puffs. n–p, Long-term monitoring of neuronal morphology and physiology in awake mice. Data are from a representative animal of four trials. z-stack images (imaging depth: 238–358 μm) of the CyRFP1 fluorescence of L2/3 neurons after SeeDB-Live treatment on days 7, 80, 100 and 120 (n). Mean calcium responses of jGCaMP8m-expressing L2/3 neurons to whisker stimulations (five times) with air puffs (o). Soma size, ΔF/F0 and half-rise time of neurons to whisker stimulation after SeeDB-Live treatment on days 7, 80, 100 and 120 (p). ΔF/F0 and half-rise (τ) time were calculated from the mean responses to five whisker stimulations. NS (P ≥ 0.05; two-sided repeated-measures analysis of variance). Data in c, d and p indicate the mean ± s.d. Images show representative samples of 2–4 trials. See Supplementary Table 4 for detailed statistical data. In the olfactory bulb, we were able to better visualize odor responses in mitral cell somata located at a depth of ~400 μm using GCaMP6f (Fig. Due to the improved brightness, inhibitory responses, represented by a reduction in basal GCaMP6f fluorescence, were better detected using SeeDB-Live (Fig. Voltage imaging is more challenging than calcium imaging in vivo due to the lower signal-to-noise ratio of the signals. However, using SeeDB-Live, we were able to reliably detect action potentials from the somata of layer 5 pyramidal neurons located at a depth of ~560 μm using JEDI-2P indicator (Extended Data Fig. Optical clearing with SeeDB-Live is transient in vivo (~1 h) as BSA is gradually washed out (Fig. To perform chronic calcium imaging with SeeDB-Live in awake animals, we used easily removable plastic films for the cranial window (Fig. A large cranial window (6 × 3 mm2) was made in one hemisphere and SeeDB-Live was applied for 1 h. A polyvinylidene chloride (PVDC) wrapping film was attached onto the window37. Refractive index–matched agarose was placed between the PVDC film and a coverslip for imaging. We obtained stable responses of GCaMP8m in S1 (615-μm depth). We did not find any changes in cytoarchitecture and sensory responses (amplitude and frequency) over 4 months, suggesting that normal neuronal functions are maintained during repeated clearing (Fig. Moreover, we observed minimal inflammatory responses after repeated clearing (Extended Data Fig. This approach could be powerful for chronic imaging of deep cortical regions. Genetically encoded voltage indicators with high signal-to-noise ratios have been developed in recent years. To image fast voltage changes, high-speed epifluorescence imaging is advantageous over point-scanning two-photon microscopy. Here we cleared acute olfactory bulb slices with SeeDB-Live and imaged calcium and voltage signals using GCaMP6f and a fast and sensitive chemigenetic voltage indicator, Voltron2, sparsely introduced to mitral/tufted cells by in utero electroporation (Fig. 6a)38; Voltron2 was visualized with JF549–HaloTag ligand applied to the medium (Voltron2549). After the clearing with SeeDB-Live, the epifluorescence signals of Voltron2549 were clearly visualized at a depth of >150 μm (Fig. Using a high-speed CMOS camera (2 kHz), we recorded voltage changes in different compartments of mitral cell dendrites. We could visualize the backpropagation of action potentials from somata to dendritic tips in single-shot imaging, without averaging (Fig. Thus, the combination of SeeDB-Live and epifluorescence imaging will be a powerful tool for studying subcellular dynamics of voltage signals in acute brain slices. a–f, Voltage imaging of a mitral cells in acute brain slices ex vivo using epifluorescence microscopy. a, Mitral cells in olfactory bulb slices. b, Mitral cells labeled with Voltron2549 at different depths under control and SeeDB-Live conditions (acquired with a high-speed CMOS camera, temporal median). Voltron2 was introduced to mitral cells by in utero electroporation and analyzed at P11. Voltron2 was labeled with Janelia Fluor HaloTag Ligand 549 before the imaging. Ticks indicate the detected action potentials. d, Two-photon image identified a labeled mitral cell (z-stacked, left). Epifluorescence of Voltron2549 (temporal median) is shown on the right. Voltron2 and GCaMP6f were introduced to mitral cells by in utero electroporation. e, Backpropagation of action potentials were imaged at 2 kHz (single-shot images) using a high-speed CMOS camera. f, Spatiotemporal pattern of backpropagating action potentials, averaged from 65 events. The half-rise time of action potentials at soma was defined as 0 ms. Median filtering (4 × 4 pixels) was applied to the images. After durotomy, the olfactory bulb was immersed with ACSF-HEPES containing 50 nM Janelia Fluor HaloTag Ligand 549 for 1 h, followed by a 1-h washout in ACSF-HEPES. SeeDB-Live treatment was then performed for 1 h. We imaged a deeper part of the glomerular layer (90 μm), where mitral/tufted cells form dendritic branches. We used a ×25 objective (NA 1.05) with a short focal depth (1.36 μm) to minimize out-of-focus signals. h,i, Epifluorescence images (temporal median) of dendrites (and some somata) of mitral/tufted cells labeled with Voltron2549 in an anesthetized mouse (4-month-old) before (h) and after (i) clearing with SeeDB-Live (1 h after clearing). F0 images at a depth of 90 μm. Magnified images are shown on the right. j, ROIs were semiautomatically detected from the F0 image using ilastik. Representative traces (−ΔF/F0) from highlighted ROIs (dendrites) are shown on the right. Ticks indicate the detected action potentials. Note that subthreshold activities were also correlated between ROIs within the same glomerulus. k, Cross-correlation matrix for voltage traces. ROIs were clustered using k-means clustering. l, Spatial distribution of ROIs in each cluster. Each color represents a different cluster. m,n, Subclusters based on spike synchronicity between ROIs within a glomerulus (cluster 2; m) and representative traces from indicated ROIs (n). o,p, Comparison of synchronicity between the subclusters in the same or different glomeruli (clusters 2 and 11; o) and representative traces of the indicated subclusters (p). Odor (1% amyl acetate) was delivered to a mouse nose for 5 s (shaded) at 1 l min−1. Data are from representative samples of two trials each. See Supplementary Table 4 for detailed statistical data. Previously, it has been challenging to image genetically encoded voltage indicator signals at deeper parts of the brain using epifluorescence imaging in vivo38,39,40. After the clearing with SeeDB-Live, L2/3 neurons located at a depth of 120–150 μm were better visualized, allowing for reliable detection of spontaneous action potentials in their somata (Extended Data Fig. We also detected backpropagating action potentials from dendrites of Voltron2-expressing L2/3 neurons in awake mice (Extended Data Fig. Next, we performed voltage imaging of mitral/tufted cells in vivo. Epifluorescence voltage imaging has been performed in the olfactory bulb, but not at the single-neuron resolution42,43. We expressed Voltron2 specifically and sparsely in mitral/tufted cells using the Pcdh21-Cre driver and a Cre-dependent adeno-associated virus (AAV) vector, labeled with JF549–HaloTag ligand (Voltron2549). As a result, we were able to detect backpropagating action potentials from ~140 neurites (regions of interest or ROIs) at a depth of ~90 μm using SeeDB-Live and epifluorescence imaging (Fig. In this imaging setup, the theoretical focal depth was ~1.36 μm (Fig. Of course, out-of-focus signals will contribute substantially to the total fluorescence, F0. However, as the fluorescence changes caused by the spikes were all-or-none and up to 2–3% ΔF/F0 (much smaller than calcium imaging), it is unlikely that scattered out-of-focus signals interfere with or contaminate spike detection (that is, −ΔF/F0) in each of the ROIs. Correlation of the voltage traces across ROIs revealed ~11 discrete clusters (Fig. The ROIs within each cluster (11 clusters by k-means) were also spatially clustered (Fig. 6l), demonstrating that neurites within the same glomerulus have similar voltage dynamics (including subthreshold changes; Fig. This makes sense because neurons connecting to the same glomerulus (‘sister' mitral/tufted cells) receive similar synaptic inputs and are electrically coupled within the glomerulus44. When we looked at individual ROIs within the same glomerulus, some pairs, but not all, demonstrated highly correlated backpropagating action potentials, suggesting that these dendritic branches originated from the same neuron (Fig. We, therefore, grouped ROIs with highly synchronized backpropagating action potentials into a subcluster. In this way, we obtained 21 subclusters, each of which most likely represents a single neuron (Extended Data Fig. Subclusters that belong to the same glomerulus (‘sister' mitral/tufted cells) tend to show more synchronized events than those in different glomeruli (Fig. We also observed odor-evoked phase shifts in action potentials relative to the sniff-coupled theta oscillations (Extended Data Fig. Thus, epifluorescence imaging of dendrites combined with SeeDB-Live provides a powerful approach for studying population voltage dynamics in vivo. To date, several studies have achieved optical clearing of live tissues, but only under unhealthy conditions for live cells. In this study, we identified the optimal refractive index and achieved optical clearing of live tissues without affecting osmolarity using BSA. Furthermore, the extracellular ionic condition was largely preserved, which is critical for studying the normal physiology of neurons. This is an advantage of SeeDB-Live over existing methods (Supplementary Table 5). Notably, the SeeDB-Live treatment demonstrated an undetectable level of toxicity to neuronal physiology and animal behavior, providing a powerful new option for imaging-based neurophysiology. Combined with wider field-of-view two-photon microscopy47,48,49,50, targeted one-photon imaging approaches39,40,51 and red-shifted indicators52, SeeDB-Live expands the imaging scale for biological phenomena at the tissue and organ scale both ex vivo and in vivo. In this study, we demonstrated that SeeDB-Live is particularly useful for epifluorescence voltage imaging. Previously, large-scale imaging of voltage changes has been difficult due to the slow scanning speed of two-photon microscopy and light scattering with one-photon microscopy. Epifluorescence imaging of dendritic voltage changes with SeeDB-Live could be a powerful strategy for studying subcellular and/or population-scale voltage dynamics both ex vivo and in vivo. However, some of the induction experiments (for example, optic cup formation31) were unsuccessful for unknown reasons. For the improved culture of organoids, microfluidic culture systems may be useful to improve circulation and/or to exchange the medium30. Alternatively, infusion into the CSF circulation system may be useful for efficient permeation of SeeDB-Live for more extensive clearing of the entire brain in the future studies53. Other organs may be more difficult to clear, and future in vivo applications would require strategies to overcome the accessibility issue. With SeeDB-Live, we can now use confocal microscopy for deep imaging, enabling high-resolution multicolor imaging. The combination of fluorescence imaging and photostimulation will be easier with one-photon and SeeDB-Live than with a multi-photon setup. As optical aberration is minimized, SeeDB-Live should also be very useful for super-resolution imaging of large volume in live tissues9,54. While we have demonstrated shadow imaging with two-photon microscopy, STED microscopy in combination with SeeDB-Live may enable saturated connectomics in acute brain slices, rather than in cultured brain slices33,34. For the best performance, it should be important to use objective lenses optimized for SeeDB-Live (refractive index, ~1.363). Together with ongoing efforts to develop microscopy techniques, our live tissue-clearing approach facilitates our understanding of the tissue-scale and organ-scale dynamics of biological phenomena. ICR and C57BL/6N mice were purchased from Japan SLC. Both males and females were used for our experiments. Mice were kept under a consistent 12-h light–12-h dark cycle (lights on at 8:00 and off at 20:00), with an ambient temperature of 20–26 °C and humidity of 40–70%. To construct pCAG-GCaMP6f, GCaMP6f gene was PCR amplified from pGP-CMV-GCaMP6f (Addgene, 40755) with Q5 High-Fidelity 2X Master Mix (M0492S, NEB). The cDNA was flanked by EcoRI and NotI sites. The GCaMP6f cDNA was subcloned into pCAG vector with a ligation kit (6023, Takara). To make pAAV-CAG-jGCaMP8f-WPRE, jGCaMP8f gene was amplified from pGP-AAV-syn-jGCaMP8f-WPRE (Addgene, 162376) with Q5 High-Fidelity 2X Master Mix. The cDNA contained an extra 20–30-bp overlap regions with pAAV-CAG-tdTomato (Addgene, 59462). The tdTomato was removed from pAAV-CAG-tdTomato by digestion with KpnI and HindIII, and jGCaMP8f cDNA with the extra sequence was subcloned into the vector with NEBuilder HiFi DNA Assembly (E2621S, NEB). pCAG-GCaMP6f plasmid has been deposited to Addgene (no. BSA was dissolved with gentle shaking at 15.6% wt/vol. We found that BSA#1 contained residual salts (~30 mM Na+ and ~1 mM Ca2+ when dissolved at 15% wt/vol; Extended Data Fig. 1e), and this was taken into account. pH was adjusted with sodium hydroxide. BSA is known to chelate Ca2+ and Mg2+. To maintain the free Ca2+ and Mg2+ concentrations the same as ACSF, additional CaCl2 (2 mM) and MgCl2 (1 mM) were supplemented after BSA was fully dissolved in the medium (except for Fig. Saturation of O2 was checked with an O2 sensor (9521, Horiba). Bubbling is not recommended because it produces a lot of foam, and BSA may be denatured. As for the culture medium, BSA#1 was dissolved in ×0.8 culture medium to adjust the osmolarity and CaCl2 (2 mM) and MgCl2 (1 mM) were supplemented. The osmolarity of the BSA solution was measured with a vapor pressure osmometer (VAPRO 5600, Xylem ELITech). The refractive index was measured with an Abbe refractometer (ER-2S, Erma) with a white LED light source. Salts contained in BSA powder were analyzed using Inductively Coupled Plasma Mass Spectrometry (Agilent Technologies, ICP-MS 7700x). We tested the following chemicals during the screening process: glycerol (17018-25, Nacalai), DMSO (043-07216, Fujifilm), propylene glycol (164-04996, Fujifilm), iodixanol (VISIPAQUE 320 INJECTION 50 ml, GE HealthCare), iodixanol (D1556-250ML, Optiprep), iotrolan (Isovist Injection 300, Bayer Pharma Japan), iopamidol (OYPALOMIN, FujiPharma), iopromide (iopromide 370 Injection (FRI), Fujifilm), iohexol (OMNIPAQUE350 INJECTION, GE healthcare Pharma), ioxilan (Imagenil350 Injection, Guerbet Japan), ioversol (Optiray350 Injection, Mallinckrodt), ioxagilic acid (Hexabrix320 Injection, Guerbet Japan), iomeprol (Iomeron400 Bracco-Eisai), Ficoll70 (17031050, Cytiva), Ficoll400 (17030010, Cytiva), HBCD (307-84601, Glico), PVP (P0471, TCI), sucrose (193-00025, Fujifilm), tartrazine (T0388, Sigma-Aldrich), ampyron (017-02272, Fujifilm), polydextrose (polydex300, Nichiga), partially hydrolyzed guar gum (2021092403, Nichiga), methyl-β-cyclodextrin (M1356, TCI), agave inulin (agabe500, Nichiga), PEG8000 (V3011, Promega), PEG10000 (81280, Sigma-Aldrich), RM + stevia (dex-5-500m, Nichiga), resistant maltodextrin from corn (RM1, MK-H108-6T6I, Nichiga), resistant maltodextrin from wheat (RM2, dekisutorin-komugi-400, Nichiga), inulin (inurinn500, Nichiga), isomaltodextrin (Fibryxa, Hayashibara), reduced resistant maltodextrin (kg-nandeki-400, Nichiga), dextran (D1662, Sigma-Aldrich) and stevia (sutebiasw5-150m, Nichiga). A step-by-step protocol and technical tips are available at SeeDB Resources (https://sites.google.com/site/seedbresources/). HeLa S3 cells (JCRB9010, JCRB) were cultured in Dulbecco's Modified Eagle Medium (DMEM high glucose; 043-300085, Fujifilm) supplemented with 1% penicillin–streptomycin and 10% fetal bovine serum (FBS) at 37 °C, 5% CO2. After centrifugation, the medium was replaced with 50 μl of index-adjusted PBS. Transmittance of the cell suspension in 400–1,100 nm was measured with a ratio beam spectrophotometer (U-5100, Hitachi High-Tech). This measurement was performed quickly because unhealthy cells have a nonoptimal refractive index, which results in reduced transmittance. HEK293T cells (AAVpro 293T, 632273, Takara) were cultured in DMEM (high glucose) supplemented with 1% penicillin–streptomycin and 10% FBS at 37 °C and 5% CO2. Cells seeded in 35-mm glass-bottom dishes (60% confluent) were transfected with pGP-CMV-GCaMP6f (Addgene, 40755) using PEI Max (Polysciences, 24765-1). Two hours after the medium exchange, cells were imaged with an inverted microscope (DMI600B, Leica) equipped with a ×10 NA 0.4 dry objective lens and controlled by LAS AF software (Leica). A final concentration of 50 μM ATP was added to the medium during imaging. For the calcium measurement with a plate reader (TriStar LB941, Berthold), GCaMP6f-expressing HEK293T cells were transferred to a 96-well plate at 4 × 105 cells per ml per well. Mean values during 1–10 s after stimulation were analyzed. To measure the viscosity of the solutions, we measured the time taken for 20 ml of solutions to flow out from a 50-ml syringe (TERMO, SS-50ESZ) with an internal tip diameter of ~2 mm. The plots were fitted by single-exponential fitting. Twenty-four hours after seeding, the medium was replaced with an index-adjusted medium (refractive index, 1.363; 310–320 mOsm kg−1). Fucci2 fluorescence (mVenus and mCherry) was imaged with an inverted fluorescence microscope (DMI600B, Leica) equipped with a ×5 NA 0.1 dry objective lens and controlled by LAS AF software (Leica). Cells were counted based on the nucleus images of Fucci2 fluorescence with ImageJ software (https://imagej.net/ij/). First, the green and red channels were summed. The speckle noise was removed with ‘Despeckle'. The overlapped nuclei were separated with ‘Watershed'. The intensity threshold was determined manually. Finally, the cell number in each well was counted with ‘Analyze particles'. Twenty-four hours after plating, the medium was replaced with an index-adjusted medium (refractive index, 1.363; 320 mOsm kg−1). After trypsinization, the cell number was counted with a hemocytometer. For spheroid formation, HeLa/Fucci2 cells were seeded on an ultralow-attachment 96-well plate (7007, Corning) at 1,000 cells per well. At 24–48 h after plating, the spheroid was incubated in an index-adjusted medium (SeeDB-Live; refractive index, 1.366; 320 mOsm kg−1) for 4 h per day or for all the time. For manual counting, the cells were incubated in a mixture of 50 μl DMEM and 200 μl Trypsin-EDTA for 30 min. The suspension was then centrifuged at 1,000 rpm for 5 min. The HeLa/Fucci2 spheroid was incubated in SeeDB-Live (refractive index, 1.366; 320 mOsm kg−1) for 1 h. Then, the spheroid was mounted on a glass slide and sealed with a 1-mm-thickness silicone rubber spacer (Togawa rubber) and a coverslip (Matsunami). Imaging was performed using an FV1000MPE microscope (Olympus/Evident) with Fluoview FV10-ASW software (Olympus/Evident, RRID: SCR_014215) and a ×25 NA 1.05 objective lens (Olympus/Evident, XLPLN25XWMP). For the two-photon imaging, a femtosecond laser (Insight DeepSee, SpectraPhysics) was tuned to 920 nm for mVenus excitation. A 1,040-nm laser was used for mCherry excitation. For cell detection, flat areas of the images were cropped. The green and red channels were merged to make reference images. A median filter was applied (2 × 2 pixels). ROIs for each cell in a spheroid were created with Cellpose61,62. Cell numbers and the fluorescence intensity were calculated based on the ROIs using MATLAB (MathWorks). 3D-rendered images were made by Imaris Viewer (Oxford Instruments). Intestinal organoids were created following the manufacturer's protocol (VERITAS). Briefly, ePET-Cre; Ai162 mice were euthanized with an overdose of pentobarbital (intraperitoneal (i.p.) injection, 100–150 mg per kg body weight). A small intestine was taken out and cut to expose the lumen side. The lumen was gently washed with cold PBS (−) several times. The small intestine was cut into 2-mm pieces in 10 ml of cold PBS (−). After pipetting three times, the supernatant was replaced with new cold PBS (−). This procedure was repeated >15 times until the supernatant became clear. The supernatant was replaced with 25 ml of Gentle Cell Dissociation Reagent (ST-100-0485, STEMCELL Technologies). The pieces were gently shaken for 15 min at room temperature. The supernatant was replaced with 10 ml of cold 0.1% BSA/PBS. After pipetting three times, the suspension was passed through a 70-µm cell strainer (352350, Corning). This step was repeated to obtain the fraction containing more crypts. After centrifugation at 200g for 3 min at 4 °C, the supernatant was replaced with 10 ml of DMEM/F-12 (11039-021, Thermo Fisher). After centrifugation at 200g, for 5 min at 4 °C, the supernatant was replaced with 150 µl of IntestiCult Organoid Growth Medium (ST-06005, STEMCELL Technologies). Matrigel (150 µl; 356237, Corning) was added to the suspension. After pipetting ten times, 50 µl of the mixture was mounted on the well of a 24-well plate. The plate was incubated for 10 min at 37 °C to gelatinize Matrigel. IntestiCult Organoid Growth Medium (750 µl) was added to the wells carefully. For imaging, the organoids were dissociated from a gel by pipetting with Gentle Cell Dissociation Reagent and transferred to a 15-ml tube. The tube was gently shaken for 10 min at room temperature. After centrifugation at 300g for 5 min at 4 °C, the supernatant was replaced with 150 µl of IntestiCult Organoid Growth Medium (osmolality, 270 mOsm kg−1). Matrigel (150 µl) was added to the suspension, and 50 µl of the mixture was mounted and spread on the glass region of a 35-mm glass-bottom dish. The mixture was gelatinized by incubation for 10 min at 37 °C. IntestiCult Organoid Growth Medium (1 ml) was added to the dish carefully. For clearing, the culture medium was replaced with SeeDB-Live/IntestiCult Organoid Growth Medium (refractive index, 1.363) 2–3 h before imaging. Phase contrast images were taken with an inverted microscope (DMI600B, Leica) equipped with a ×10 NA 0.4 dry objective lens and controlled by LAS AF software (Leica). Fluorescence of EECs in an organoid was imaged with an inverted confocal microscopy (TCS SP8, Leica) equipped with ×20 NA 0.75 multi-immersion lens and LASX software (Leica Microsystems). A 488-nm laser was used to excite GCaMP6s expressed in EECs. To measure the Ca2+ responses of EECs, KCl (+30 mM at final concentrations) was added to the medium during imaging. Mouse embryonic stem cells were maintained as described in the previous study31. The cell line was provided by M. Eiraku at Kyoto University. Cells were maintained as described in the previous study31. For maintenance, cells were cultured in a gelatin-coated 100-mm dish. The dish contained maintenance medium, to which 20 µl of 106 units per ml leukemia inhibitory factor (Sigma-Aldrich) and 20 µl of 10 mg ml−1 blasticidin (14499, Cayman) were added. The maintenance medium consisted of Glasgow's Modified Eagle Medium (G-MEM; 078-05525, Wako) supplemented with 10% Knockout Serum Replacement (KSR; 10828028-028, GIBCO), 1% FBS (GIBCO), 1% Non-essential Amino Acids (NEAA; 139-15651, Wako), 1 mM pyruvate (190-14881, Wako) and 0.1 mM 2-mercaptoethanol (2-ME; M6250, Sigma-Aldrich). The solution was filtered through a 0.2-μm filter bottle, stored at 4 °C, used within 1 month. For organoid induction, the serum-free floating culture of embryoid body-like aggregates with quick reaggregation (SFEBq) culture method was performed as described in a previous study31. On day 1, Matrigel (354230, Corning) was mixed with the differentiation medium and added to each well to reach a final concentration of 2.0%. This plate was incubated at 37 °C in a 5% CO2 environment. The differentiation medium consisted of G-MEM supplemented with 1.5% KSR, 1% NEAA, 1% pyruvate and 0.1% 0.1 M 2-ME. This solution was filtered through a 0.2-μm filter bottle, stored at 4 °C and used within 1 month. For imaging, Matrigel surrounding the organoids was reduced by pipetting gently in advance. Then the organoids were transferred from the 96-well plate to a 35-mm glass-bottom dish (D11130H, Matsunami) coated with 0.1% (wt/vol) poly-L-lysine solution in H2O (P8920, Sigma-Aldrich) and 2.5 mg ml−1 Cell-Tak (354240, Corning). Images were captured using an LSM 800 (Zeiss) equipped with a ×25 NA 0.8 multi-immersion lens and controlled by Zen software (Zeiss, RRID: SCR_013672). On day 9 in SFEBq culture, 145 images were taken for each organoid at different z-positions with 3-µm intervals within 432 µm. Organoids were incubated for 2 h in SeeDB-Live medium adjusted at 270 mOsm kg−1. Small incisions were made in the organoid by randomly inserting a glass capillary five times to facilitate penetration of SeeDB-Live into the internal vesicle. Cultures for cortical organoid induction were performed as described in the study63. In this method, the cortical organoid differentiation medium consisted of G-MEM supplemented with 10% KSR, 1% NEAA, 1% pyruvate and 0.1% 0.1 M 2-ME. The solution was filtered through a 0.2-μm filter bottle, stored at 4 °C and used within 1 month. On day 0, 3,000 cells were suspended in 100 µl of differentiation medium and placed in each well of a 96-well plate. The plates were incubated at 37 °C in a 5% CO2 environment. On day 7, the aggregates were transferred to a 35-mm bacterial-grade dish containing DMEM/F-12 with Glutamax (10565, Invitrogen) supplemented with N2 (17502-048, Invitrogen) and incubated in a 5% CO2, 40% O2 environment at 37 °C. The medium was changed every 3 days. For Ca2+ imaging, the organoids were incubated with 5 µM Calbryte 630 (20721, AAT Bioquest) for 1 h, transferred to a 35-mm glass-bottom dish and covered with cover glass (Matsunami). Images were captured using an LSM 800 (Zeiss) equipped with a ×25 NA 0.8 multi-immersion lens and controlled by Zen software (Zeiss, RRID: SCR_013672). On day 36 in SFEBq culture, 145 images were taken for each organoid at different z-positions with 3-µm intervals within 432 µm. Organoids were incubated for 1 h in SeeDB-Live medium. AAV-DJ-syn-jGCaMP8m-WPRE vector was generated using pGP-AAV-syn-jGCaMP8m-WPRE (Addgene, 162375), pHelper (AAVpro Helper-free system, Takara), pAAV-DJ (Cell Biolabs) and the AAVpro 293T cell line (632273, Takara) following the manufacturers' instructions. Transfection was performed with PEI Max (24765-1, PSI). AAV vectors were purified using the AAVpro Purification Kit All Serotypes (6666, Takara). AAV.PHP.S-CAG-jGCaMP8f-WPRE vector was generated using pAAV-CAG-jGCaMP8f-WPRE, pHelper, pUCmini-iCAP-PHP.S (Addgene, 103006) and the AAVpro 293T cell line as described previously64. Briefly, the conditioned medium containing AAV vectors was filtered with a syringe filter to remove cell debris at 6 days after transfection. The filtered medium was concentrated and formulated with D-PBS (−) using the Vivaspin 20 column pretreated with 1% BSA in PBS. Viral titers were measured using AAVpro Titration Kit (6233, Takara) or THUNDERBIRD SYBR qPCR Mix (QPS-201, TOYOBO) with StepOnePlus system (Thermo Fisher) or QuantStudio3 real-time PCR system (Applied Biosystems). Primary cultures of cardiomyocytes were prepared from P0 ICR mice as previously described65. The pups were anesthetized on ice and decapitated. The hearts were dissected and washed in PBS (−) containing 20 mM 2,3-butanedione monoxime (B0753, Sigma). The hearts were cut into 0.50–1-mm pieces in Hanks' Balanced Salt solution (HBSS (−); 084-08345, Fujifilm) containing 0.08% Trypsin-EDTA and 20 mM 2,3-butanedione monoxime and shaking at 4 °C for 2 h. L15 medium (128-06075, Fujifilm) containing 1.5 mg ml−1 collagenase/Dispase mix (10269638001, Roche) and 20 mM 2,3-butanedione monoxime was added. Thirty minutes after shaking at 37 °C, the suspension was filtered through a 70-μm cell strainer. The trapped heart tissues were transferred to an L15 medium containing 1.5 mg ml−1 collagenase/Dispase mix and 20 mM 2,3-butanedione monoxime and incubated for 10 min at 37 °C. After centrifugation at 100g for 5 min, the pellet was resuspended with DMEM (high glucose) supplemented with 1% penicillin–streptomycin and 10% FBS. The suspension was mounted on a cell culture dish for 2 h. This helped the removal of highly adhesive cells. After gentle pipetting, the suspension was collected and plated on 35-mm dishes at 1.2 × 105 cells per cm2. The cells were cultured in DMEM (high glucose), without phenol red and glutamine (040-30095, Fujifilm) supplemented with 1% penicillin–streptomycin, 10% FBS and 1% glutamine at 37 °C, 5% CO2. On day 1 in vitro (DIV-1), AAV.PHP.S-CAG-jGCaMP8f-WPRE was added at 2 × 1010 genome copies (GCs) per ml. On DIV-2, the culture medium was exchanged. The spontaneous activity of cardiomyocyte aggregates was measured with a Leica TCS SP8 equipped with a ×20 NA 0.75 multi-immersion lens and LASX software (Leica Microsystems) at DIV-3 to DIV-5. Phase contrast images were taken with an inverted microscope (DMI600B, Leica) equipped with a ×10 NA 0.4 objective lens and controlled by LAS AF software (Leica). Primary cultures of hippocampal neurons were prepared from embryonic day 16 ICR mice. The brain was extracted and put into a cold dissection medium consisting of HBSS (−) supplemented with 20 mM HEPES and 1% penicillin–streptomycin solution. Papain (2 mg ml−1; LS003119, Worthington)/HBSS (−) was activated for 5 min at 37 °C. After filtration, the hippocampi were transferred to papain/HBSS (−) and incubated for 20 min at 37 °C. A total of 1 ml of 150 mg ml−1 DNase I (11284932001, Roche)/HBSS (−) was added to the papain/HBSS (−) containing the hippocampi. The hippocampi were incubated for 5 min at 37 °C. The hippocampi were washed twice with 2 ml of HBSS (−). The cells were dissociated with gentle pipetting using a Pasteur pipette (Iwaki). The cells were then plated on a 35-mm glass-bottom dish coated with poly-D-lysine (P7886, Sigma) at 1.5 × 105 cells on a 12-mm-diameter coverslip and cultured in 5% CO2 at 37 °C. On DIV-2, AAV-DJ-hsyn-jGCaMP8m-WPRE was added at 7 × 1010 GCs per ml after half of the culture medium in the dishes was transferred to a 50-ml tube. On DIV-7, half of the culture medium was transferred to a 50-ml tube. SeeDB-Live (refractive index, 1.363) was made from this culture medium together with the same amount of fresh medium. The spontaneous activity was measured with a Leica TCS SP8 equipped with a ×20 NA 0.75 multi-immersion lens and LASX software (Leica Microsystems) on DIV-8 to DIV-10. Phase contrast images were taken with an inverted microscope (DMI600B, Leica) equipped with a ×20 NA 0.7 objective lens and controlled by LAS AF software (Leica). ICR mice (P5) were anesthetized on ice and euthanized by decapitation. The brain was mounted on a silicone rubber block (Togawa Rubber) and sliced at 300-μm thickness using a microslicer (Dosaka EM). Slices were recovered in O2-saturated ACSF for 1 h at room temperature and then cleared with SeeDB-Live. An upright microscope (Leica, S9E) equipped with a USB camera (Swift, EC5R) was used for image acquisition. Thy1-GCaMP6f mice (P11–15) were used for Ca2+ imaging of the acute olfactory bulb slices. Thy1-YFP-H mice (P17–22) were used for morphological analyses. Mice were euthanized with an overdose of pentobarbital (i.p. injection, 100–150 mg per kg body weight) and decapitated. The brain was mounted on a silicone rubber block (Togawa rubber) and sliced using a microslicer (Dosaka EM) at 300-μm thickness. The slices were placed on a custom-made silicone chamber for imaging using an upright microscope as previously described35,66. For clearing, the brain slices were perfused with SeeDB-Live for 1 h. To remove SeeDB-Live from tissue, ACSF was perfused for >1.5 h. We could record spontaneous activity of the olfactory bulb up to 5 h. The custom-made silicone chamber was set under an FV1000MPE microscope (Olympus/EVIDENT) with Fluoview FV10-ASW software (Olympus/Evident, RRID: SCR_014215) and a ×25 NA 1.05 water-immersion objective lens (Olympus/Evident, XLPLN25XWMP). A perfusion chamber (Warner Instruments, JG-23W/HP, PM-1, SHD-26GH/10) was used for inverted imaging. The correction collar was turned to the appropriate positions (refractive index ~1.34 for control and ~1.363 for SeeDB-Live). For one-photon confocal imaging, a 473-nm laser was used. For two-photon imaging, a femtosecond laser (InSight DeepSee, SpectraPhysics) was tuned to 920 nm. For stimulation, 100 μM NMDA (Nacalai, 22034-1) and 40 μM glycine (Sigma, G7126-100G) in ACSF or SeeDB-Live/ACSF was applied during Ca2+ imaging. Imaging data were analyzed with ImageJ. Briefly, small drifts were corrected by the Image Stabilizer plugin for ImageJ (https://imagej.net/plugins/image-stabilizer) when necessary. After fluorescence intensity was obtained, the data were analyzed with MATLAB software (MathWorks). The F0 was calculated by temporal median filtering (ten-frame window). After the signal was filtered with temporal median filtering (three-frame window), the ‘findpeaks' function was applied for peak detection. Acute brain slices were prepared from wild-type C57BL/6N mice (P18, male and female). The slice was mounted on a custom-made silicone chamber for imaging using an upright microscope as previously described35,66. Calcein (40 μM) was added to the ACSF. The slice was perfused with ACSF containing 40 μM calcein for 1 h. For clearing, the slice was perfused with SeeDB-Live containing 40 μM calcein for 1 h. For imaging, two-photon microscopy (MM201, Thorlabs) equipped with a 25x NA 1.05 water-immersion objective lens (Olympus/Evident, XLPLN25XWMP) and ThorImageLS software (Thorlabs) was used. A 920-nm femtosecond laser (ALCOR 920-4 Xsight, SPARK LASERS) was used. Liquid junction potential (LJP) was determined for ACSF and SeeDB-Live/ACSF as described previously (Extended Data Fig. We filled the recording electrode with internal solution and the reference electrode with 3 M KCl. The two electrodes were sequentially inserted into internal solution, ACSF and SeeDB-Live/ACSF while recording under current-clamp mode to measure potentials in each solution (VIN, Vcontrol-ACSF, VSeeDB-Live/ACSF). C57BL/6J mice (male and female) were purchased from Japan SLC. Mice were deeply anesthetized with isoflurane. For P14–18 mice, brains were quickly removed from mice and put into ice-cold ACSF bubbled with 95% O2 and 5% CO2. Acute coronal slices (300-µm thick) containing S1 were prepared using a vibratome (VT1200S, Leica). The slices were recovered in ACSF for at least 1 h at room temperature (23–24 °C) before recording for the control condition. For the SeeDB-Live condition, following the recovery in ACSF for 1 h, the slices were transferred into SeeDB-Live solution saturated with 95% O2 and 5% CO2 for 1 h at room temperature. For the P15–18 L5ET neurons, all the recordings were performed within 6 h after recovery (4 h after clearing). For the P14–18 fast-spiking interneurons and P28–29 L5ET neurons, all the recordings were performed within 6 h after recovery. Recording was extremely difficult when cleared with SeeDB-Live, even using infrared differential interference contrast. We tried to minimize the sampling bias by limiting the recording period after sample preparation. Consistent sampling (for example, cell type and depth) was confirmed. Neurons were visualized by an infrared differential interference contrast video microscope with a ×60, NA 1.0 water-immersion lens. L5ET neurons (thick-tufted L5 neurons with large cell bodies) and L5 fast-spiking interneurons with high-frequency spiking and little adaptation were analyzed. Neurons whose cell bodies were located deeper than 35 µm from the slice surface were recorded. Neurons were almost invisible under SeeDB-Live. Recordings were performed using MultiClamp700B amplifiers (Molecular Devices), filtered at 10 kHz using a Bessel filter and digitized at 20 kHz with Digidata 1440 A digitizer (Molecular Devices), and stored using pClamp10 (Molecular Devices). A series resistance compensation was not used for recordings. To characterize firing properties, hyperpolarizing and depolarizing square current pulses were injected under current-clamp mode (+50-pA increment, 1 s). In characterizing membrane properties, the membrane potential was clamped at −60 mV, and square pulses (−5 mV, 50 ms) were applied in voltage-clamp mode. sEPSCs were recorded at the holding potential of −60 mV. Transient negative current responses with a peak amplitude of <−10 pA were detected as sEPSCs. The morphologies of the recorded neurons were visualized by staining biocytin with streptavidin-Cy3 (1:1,000 dilution, S6402; Sigma-Aldrich) after recording. Fluorescence images were obtained using confocal microscopy (LSM900, Zeiss) equipped with a ×10 objective lens and controlled by Zen software (Zeiss, RRID: SCR_013672). In utero electroporation was performed as described previously35. To label mitral cells at embryonic day 12 (E12), 1 μg each of pCAG-GCaMP6f and pGP-pcDNA3.1 Puro-CAG-Voltron2 (Addgene, 172909) plasmids were injected into the lateral ventricle. Electric pulses (a single 10-ms poration pulse at 72 V, followed by five 50-ms driving pulses at 40 V with 950-ms intervals) were delivered along the anterior–posterior axis of the brain with forceps-type electrodes (3-mm diameter, LF650P3, BEX) and a CUY21EX electroporator (BEX). Electric pulses (a single 10-ms poration pulse at 72 V, followed by five 50-ms driving pulses at 42 V with 950-ms intervals) were delivered toward the mediolateral axis of the brain with forceps-type electrodes (5-mm diameter, LF650P5, BEX) and an electroporator (CUY21EX, BEX). Voltage imaging with Voltron2 was performed in acute brain slices of P4–11 ICR mice (male and female) subjected to in utero electroporation at E12. Mice were anesthetized in ice and decapitated. The brain was mounted on a silicone rubber block (Togawa rubber) and sliced using a microslicer (Dosaka EM) at 300-μm thickness. The slices were incubated in O2-saturated ACSF containing 50 nM Janelia Fluor HaloTag Ligand 549 (GA1110, Promega) at room temperature for 1 h. After placing on a custom-made silicone chamber, the slices were then washed under the perfusion of O2-saturated ACSF for 1 h (2 h for control experiment) at room temperature. The chamber was set under an FV1000MPE microscope (Olympus/Evident) with Fluoview FV10-ASW software (Olympus/Evident, RRID: SCR_014215) and a ×25 NA 1.05 water-immersion objective lens (Olympus/Evident, XLPLN25XWMP). For epifluorescence imaging, a mercury arc lamp was used. Epifluorescence was imaged with a high-speed CCD camera (MiCAM02-HR or MC03-N256, BrainVision) at 0.3–7 ms per frame. For two-photon imaging of GCaMP6f, a femtosecond laser (InSight DeepSee, SpectraPhysics) was tuned to 920 nm. Image data were analyzed with ImageJ. Small drifts were corrected by the Image Stabilizer plugin. After fluorescence intensity was obtained, the data were analyzed with MATLAB software (MathWorks). The F0 was calculated as temporal median filtering (100-frame window). For peak detection, the ‘findpeaks' function was applied. Voltage changes within a mitral cell (single-trial data) were visualized with BV Workbench (BrainVision). A two-dimensional mean filter (3 × 3 pixels), drift removal (polyfit, degree 3) and a Savitzky–Golay filter (32 points, window size of five frames) were applied. C57BL/6N mice (2- to 4-month-old, male and female) were used. Surgery and imaging were performed using ketamine (Daiichi-Sankyo) and xylazine (Bayer; 80 mg per kg body weight and 16 mg per kg body weight, respectively) anesthesia. During surgery, the depth of anesthesia was assessed by the toe-pinch reflexes, and supplemental doses were added when necessary. Body temperature was maintained with a heating pad (Akizuki, M-08908). The dura matter was carefully removed by a micro hook (durotomy; 10065-15, Muromachi Kikai). BSA-CF594 (1 mg; 20290, biotium) was dissolved in 100 μl SeeDB-Live/ACSF-HEPES. SeeDB-Live/ACSF-HEPES (50–100 μl; 1% BSA-CF594) was mounted onto the brain surface. The solution was stirred for 1 h using a gelatin sponge (Spongel, LTL Pharma). Mice were euthanized with an overdose of pentobarbital (100–150 mg per kg body weight, i.p.) The brain was embedded in OTC compound (4583, Sakura Finetek) and frozen with liquid nitrogen. The frozen sections were made with a cryostat (CM3050S, Leica) and immediately imaged with an inverted microscope (DMI600B, Leica) equipped with a ×5 NA 0.1 dry objective lens and controlled by LAS AF software (Leica). Adult Thy1-YFP-H mice (1- to 6-month-old, male and female) were anesthetized with a mixture of ketamine (Daiichi-Sankyo; 80 mg kg−1 body weight) and xylazine (Bayer; 16 mg kg−1 body weight); 15% mannitol solution (3 ml per 100 g body weight; Sigma-Aldrich, M4125) was then administered intraperitoneally. After the durotomy, bleeding was stopped with a gelatin sponge (LTL Pharma, Spongel). The brain surface was perfused with ACSF-HEPES, then switched to SeeDB-Live/ACSF-HEPES and perfused for 1 h at a flow rate of 1.5 ml min−1. The fluorescence of L5ET neurons was imaged using a two-photon microscope (MM201, Thorlabs) equipped with a ×25 NA 1.05 water-immersion objective lens (Olympus/Evident, XLPLN25XWMP) and ThorImageLS software (Thorlabs). The correction collar was turned to the appropriate positions (refractive index ~1.34 for control and ~1.363 for SeeDB-Live). A 920-nm femtosecond laser (ALCOR 920-4 Xsight, SPARK LASERS) was used. Anesthetized adult C57BL6/J mice (~7-week-old, male and female) were used for in vivo calcium imaging of V1. Under isoflurane anesthesia (2%) together with calprofen (10 mg per kg body weight), atropine (0.3 mg per kg body weight) and dexamethasone (2 mg per kg body weight), a craniotomy and durotomy was performed over the V1 (2.2-mm square). Half of the exposed cortex was covered with a piece of square coverslip (2 × 1 mm), and the other half was directly in contact with an extracellular solution for a subsequent pipette insertion and SeeDB-Live/ACSF-HEPES application. Anesthesia was continued at a lower concentration of isoflurane (0.125–0.5%), supplemented with chlorprothixene (1 mg per kg body weight, Sigma)69. Body temperature was maintained at 37 °C using a feedback-controlled heating pad. Then, the mice were placed under a two-photon microscope (Bermago II, Thorlabs). jGCaMP8m expression was achieved by AAV-DJ-Syn-jGCaMP8m-WPRE (4.1 × 1014 GCs per ml, 150 nl at a depth of 350 μm, three sites 200 μm apart), and jGCaMP8m was excited at 980 nm (MaiTai DeepSee eHP, SpectraPhysics). The Cal-520 AM solution also included 50 μM Alexa Fluor 594 (Sigma) to visualize dye-loading pipettes (at 1,070 nm excitation by Fidelity-2, Coherent). Cal-520 AM solution was pressure injected (150 mbar, 2 min), and after an incubation time of 1 h, two-photon imaging experiments were performed. Two-photon excitation of Cal-520 was at 920 nm (MaiTai DeepSee eHP, SpectraPhysics). Visual stimulation was presented at an LCD monitor (iPad 3/4 Retina Display, Adafruit, refresh rate of 60 Hz, gamma corrected), which was placed contralateral to the craniotomy side, covering an angle of 100° horizontal and 80° vertical in the visual hemifield. The monitor was moved and placed at a position that could evoke maximal full-field calcium response. The stimulation was controlled by MATLAB programs originally developed by Cortex Lab at University College London69. Full-screen sinusoidal drifting gratings were presented randomly at one of the eight directions (0–315°, 45° step) together with a blank condition. After obtaining a visual response to the drifting gratings in the control condition of ACSF-HEPES (more than 15 repeats), solution under the objective lens (~1 ml) was replaced with SeeDB-Live/ACSF-HEPES. After an additional 1-h incubation, we confirmed that baseline brightness was increased for jGCaMP8m and visual response to the same set of drifting gratings was obtained in the presence of SeeDB-Live/ACSF-HEPES. Calcium traces for each cell were computed offline using a Python version of Suite2p62. ROIs were drawn over cells, and fluorescence signal for each ROI was extracted. Neuropil contamination was not corrected, considering correction factor could be different in the presence and absence of SeeDB-Live. Visual response for each cell was further analyzed using MATLAB. First, visual responsiveness was evaluated by Kruskal–Wallis test using calcium response across eight directions plus the blank conditions. Orientation selectivity was judged by Kruskal–Wallis test using the response at eight-direction conditions. Orientation response was fitted with the sum of two Gaussian curves. The tuning width was measured as full width at half maximum height of the fitted curve. The maximum response was average calcium signal at an orientation closest to the preferred orientation. AAV1-Syn-FLEX-Volton2-ST-WPRE (Addgene, 172907-AAV1) was injected into 2-month-old Pcdh21-Cre mice (male and female) for in vivo voltage imaging. Surgery was performed under ketamine (Daiichi-Sankyo) and xylazine (Bayer; 80 mg and 16 mg per kg body weight, respectively) anesthesia. A small circle (~1 mm in diameter) was made with a dental drill over the right olfactory bulb. The AAV1 vector was injected into the center of the dorsal olfactory bulb (200-µm depth), over a 12-min period, using a Nanoject III injector (Drummond Scientific Company). Before imaging, mice were subjected to surgery under ketamine and xylazine (80 mg and 16 mg per kg body weight, respectively) anesthesia. After a craniotomy and durotomy over the right olfactory bulb, a silicone sealant rim was created around the window to maintain fluid over the brain surface. Around 50–100 μl of ACSF-HEPES or SeeDB-Live/ACSF-HEPES was applied onto the brain surface for 1 h. After removing a silicone sealant rim, a circular coverslip (2-mm diameter) was mounted on the brain surface and fixed with a superglue and silicone sealant. Anesthetized adult Thy1-GCaMP6f mice (2- to 4-month-old, male and female) were used for imaging. The fluorescence of mitral cells was imaged using an FV1000MPE microscope (Olympus/Evident) with Fluoview FV10-ASW software (Olympus/Evident, RRID: SCR_014215) and a ×25 NA 1.05 objective lens (Olympus/Evident, XLPLN25XWMP). The correction collar was turned to the appropriate positions (refractive index ~1.33 for control and ~1.363 for SeeDB-Live). Small drifts were corrected by the Image Stabilizer plugin. After fluorescence intensity was obtained, the data were analyzed with MATLAB software (MathWorks). The surface of the olfactory bulb was immersed with ACSF-HEPES containing 50 nM Janelia Fluor HaloTag Ligand 549 to label Voltron2 for 1 h, followed by a 1-h washout in normal ACSF-HEPES. SeeDB-Live treatment was then performed for 1 h. Mice were placed on an FV1000MPE microscope (Olympus/Evident) and a ×25 NA 1.05 water-immersion objective lens (Olympus/Evident, XLPLN25XWMP). For excitation, a mercury arc lamp was used. Epifluorescence was imaged with a high-speed CCD camera (MC03-N256, BrainVision) at 1–7 ms per frame. Imaging data were analyzed using ImageJ. Small drifts were corrected using the Image Stabilizer plugin. ROIs were generated using a machine learning-based image segmentation tool (ilastik)72. Further analysis was performed using MATLAB software (MathWorks). ROIs smaller than five pixels and/or outside the glomeruli were excluded. F0 was calculated by temporal median filtering (25 frames window). k-means clustering was applied with k = 11 (the number of glomeruli). To define subclusters, the spike synchronicity index between ROIs was calculated. Spikes were detected using the findpeaks function. Thresholds were set at mean + 1.5 times the s.d. for the clustering and final spike detection, respectively. A synchronous event was defined when the spike in one ROI was detected within ±7 ms (21-ms window) of the spike in another ROI. The synchronicity index was calculated by dividing the number of synchrony events by half of the total number of spikes in two ROIs. Hierarchical clustering was used to define subclusters. To make a reference for the phase analysis, the averaged ΔF/F0 was calculated from all glomeruli. Odor stimulation using an olfactometer was described previously46. The olfactometer consists of an air pump (AS ONE, 1-7482-11), activated charcoal filter (Advantec, TCC-A1-S0C0 and 1TS-B) and flowmeters (Kofloc, RK-1250). Valeraldehyde (TCI, V0001) and amyl acetate (FUJIFILM-Wako, 018-03623) were diluted at 1% (vol/vol) in 1 ml mineral oil in a 50-ml centrifuge tube. Saturated odor vapor in the centrifuge tube was delivered to a mouse nose with a Teflon tube. Diluted odors were delivered for 5 s at 1 l min−1. After durotomy, bleeding was stopped with a gelatin sponge (Spongel, LTL Pharma). The brain surface was perfused with ACSF-HEPES, then switched to SeeDB-Live/ACSF-HEPES for 1 h at 1.5 ml min−1. A commercially available PVDC wrapping film (Asahi Kasei, Asahi Wrap or Saran Wrap, ~11-μm thick) with a ~1-mm margin was applied to the cranial window and firmly attached to the skull with superglue. Agarose (1.5% wt/vol) with or without 19.3% wt/vol glycerol (refractive index, 1.363) was filled between the film and a glass coverslip (Matsunami 18 × 18 no.1). After imaging, the agarose was replaced with a transparent silicone elastomer (GC, Exaclear) and a glass coverslip was applied on top. The coverslip was then sealed with waterproof film. To minimize inflammation after the surgery, dexamethasone sodium phosphate (4 mg ml−1) was administered intramuscularly into the quadriceps muscle at a dose of 2 µg per gram of body weight immediately before surgery. Additionally, carprofen (0.50 mg ml−1) was administered via subcutaneous injection at a dosage of 5 mg per kg body weight once daily for 3 consecutive days following the surgery to manage postoperative pain and inflammation. jGCaMP8m was introduced by the combination of the injection of 300 nl AAV-DJ-CAG-FLEX-jGCaMP8m-P2A-CyRFP (1.8 × 1011 GCs per ml) to S1 and intravenous injection of 100 μl AAV.PHPeB-mscRE4-minBGpromoter-iCre-WPRE-hGHpA (7.4 × 1010 GCs per ml; Addgene, 163476)73 to the retro-orbital venous sinus. The cranial window with a plastic wrap was carefully removed with a scalpel for repeated clearing experiments. Whisker stimulation was performed with air puffs produced by Picospritzer (Parker). Inflammation should be minimized during the procedure as this can potentially trigger the immune response to BSA. Image data were analyzed with MATLAB (MathWorks). Small drifts were corrected by the rigid motion-correction program (https://github.com/flatironinstitute/NoRMCorre/). For voltage imaging of L2/3 neuron somata from P17–30 ICR mice (male and female) subjected to in utero electroporation at E15, surgery and imaging were performed under urethane (Sigma, U2500) anesthesia (1.9 g per kg body weight). For imaging of the dendrites from the 2-month-old ICR mice, surgery was performed under isoflurane anesthesia (2.5% for induction, 1–1.3% for surgery, flow rate of 0.3–0.6 l min−1). A custom-made headpost was attached with a dental cement (GC Dental Products Corporation, UNIFAST II). After a craniotomy and durotomy (3–5 mm in diameter) over S1, a silicone sealant rim was created around the window to maintain fluid over the brain surface. In total, 50–100 μl of ACSF-HEPES containing 50 nM Janelia Fluor HaloTag Ligand 549 (GA1110, Promega) was applied onto the brain surface for 1 h. After removing the mounted solution, 50–100 μl of ACSF-HEPES was mounted for 1 h (2 h for control experiment). For clearing, SeeDB-Live/ACSF-HEPES was applied onto the brain surface for 1 h. After removing a silicone sealant rim, a circular coverslip (3 mm in diameter, thickness of 0.17 mm for P17–30, 0.34 mm for 2-month-old mice) was fixed with superglue. The mice were placed on an FV1000MPE microscope (Olympus/Evident) and a 25x NA 1.05 water-immersion objective lens (Olympus/Evident, XLPLN25XWMP). For excitation, a mercury arc lamp was used. Epifluorescence was conducted with a high-speed CCD camera (MC03-N256, BrainVision) at 1–3 ms per frame. Image data were analyzed with MATLAB (MathWorks). Small drifts were corrected by the rigid motion-correction program (https://github.com/flatironinstitute/NoRMCorre/). The F0 was calculated by temporal median filtering (100-frame window). For video, a 3D median filter (1 pixel radius) was applied. 105558-AAV1) were injected at a 3:1 ratio into 2-month-old C57BL/6N mice (male and female). Surgery was performed under ketamine (Daiichi-Sankyo) and xylazine (Bayer; 80 mg and 16 mg per kg body weight, respectively) anesthesia. A small circle (~1 mm in diameter) was made with a dental drill over the right S1. The AAV1 vectors were injected into the right S1 (3 mm lateral to the midline, 1 mm caudal to bregma at a depth of 300 μm), over a 12-min period, using a Nanoject III injector (Drummond Scientific Company). A custom-made headpost was attached with a dental cement (GC Dental Products Corporation, UNIFAST II). Before imaging, mice were subjected to surgery under isoflurane anesthesia (2.5% for induction, 1–1.3% for surgery, flow rate of 0.3–0.6 l min−1). After a craniotomy and durotomy over the right S1, 50–100 μl of SeeDB-Live/ACSF-HEPES was applied onto the brain surface for 1–2 h. A circular coverslip (3 mm in diameter, thickness of 0.34 for 2-month-old ICR mice) was mounted on the brain surface and fixed with a superglue. The mice were placed under a resonant two-photon microscope (MM201, Thorlabs) equipped with a ×25 NA 1.05 water-immersion objective lens (Olympus/Evident, XLPLN25XWMP) and ThorImageLS software (Thorlabs). Immersion was performed using 15.6% (vol/vol) TDE/ddH2O (refractive index, 1.363). The correction collar was turned to the appropriate positions (refractive index ~1.33 for control and ~1.363 for SeeDB-Live). A 920-nm femtosecond laser (ALCOR 920-4 Xsight, SPARK LASERS) was used. Image data were analyzed with MATLAB (MathWorks). Small drifts were corrected by the rigid motion-correction program (https://github.com/flatironinstitute/NoRMCorre/). The F0 was calculated by temporal median filtering (15-frame window). Behavioral experiments were performed to evaluate the acute and chronic toxicity of SeeDB-Live treatment. C57BL/6N mice (2-month-old, male and female) were used. We made a large cranial window with a plastic film window (3 × 6 mm2) for the optical clearing of the right cortex as described above. At ≥3 days after surgery, mice were anesthetized with isoflurane (2% for induction, 0.7–1.0% during surgery) and injected with 15% mannitol solution (3 ml per 100 g body weight; Sigma-Aldrich, M4135). The plastic film and silicone were carefully removed. Then, SeeDB-Live/ACSF-HEPES or ACSF-HEPES was perfused onto the brain surface at a rate of 1.5 ml min−1 for 1 h. For acute behavioral experiments, head-fixed mice were placed on a custom-built treadmill 1 h after recovery from anesthesia. The treadmill consisted of a freely rotating roller with eight embedded magnets, which were detected by a sensor to monitor locomotion. Locomotion was recorded at 10 kHz for 10 min using PowerLab (AD Instruments). A transparent silicone elastomer (GC, Exaclear) and a glass coverslip (Matsunami 18 × 18 no.1) were then applied on top of the film. For long-term behavioral experiments, the film was reapplied to the cranial window and firmly secured to the skull with superglue after the application of SeeDB-Live/ACSF-HEPES or ACSF-HEPES for 1 h. A transparent silicone elastomer (GC, Exaclear) and a glass coverslip (Matsunami, 18 × 18 mm, no. 1) were then placed on top of the wrap. A cortical ischemia model was used for control experiments. Photosensitive dye (150 μg per gram of body weight; Rose Bengal) was i.p. injected, and the right cortical surface was irradiated through the skull with a white LED (Leica, KL300LED, 50 W) for 10 min. For locomotion measurements, mouse locomotion in an open chamber (30 × 25 cm) was recorded for 10 min using a USB camera (eMeet, SmartCam C960). Locomotion was tracked and analyzed with ezTrack74 under uniform ambient lighting. To assess changes in motor function, a wire hanging test was performed as described55. Mice were placed on a wire mesh (1-mm diameter wire, 10 × 10-mm grid) and allowed to grip the mesh. Wire hanging requires motor cortex but does not require pretraining. To monitor the food intake, mice were individually housed in cages with ad libitum access to food and water. Mice were kept under a 12-h light–dark cycle. C57BL/6N mice (2-month-old to 4-month-old, male and female) were used. In addition, a 10-month-old mouse was used for the long-term SeeDB-Live treatment experiment. In this mouse, jGCaMP8m was introduced by a 300-nl injection of AAV-DJ-CAG-FLEX-jGCaMP8m-P2A-CyRFP (1.8 × 1011 GCs per ml) into S1 and an intravenous retro-orbital injection of 100 μl AAV. We made a large cranial window with a plastic film window (3 × 6 mm2) on the right cortex as described above. Ten days after the surgery, mice were anesthetized with isoflurane (2% for induction, 0.7–1.0% during surgery) and injected with 15% mannitol solution (3 ml per 100 g body weight; Sigma-Aldrich, M4135). The film and silicone were carefully removed. Then, either SeeDB-Live/ACSF-HEPES or ACSF-HEPES was perfused onto the brain surface at a rate of 1.5 ml min−1 for 1 h. Then, the cranial window was sealed with plastic film, silicone and the coverslip, as described above until the next day. In the mouse with repeated SeeDB-Live treatments, the treatment was initiated immediately after the window surgery and was repeatedly performed over a period of 7 months (day 0, 3, 7, 80, 100, 120 and 218). Mice were deeply anesthetized by an overdose of pentobarbital (i.p. Anesthetized mice were perfused with 4% PFA in PBS. Excised brain samples were then fixed with 4% PFA in PBS at 4 °C overnight. The samples were cryoprotected with 30% sucrose at 4 °C overnight and embedded in OCT compound (Sakura). Frozen brains were cut into 16-μm-thick coronal sections using a cryostat (Leica). Sections were blocked with 10% normal donkey serum or 1% BSA in PBS for 1 h and then incubated with primary antibodies in 10% normal donkey serum or 1% BSA in PBS at 4 °C overnight. After washing three times in PBS with 0.05% Tween20, sections were incubated with secondary antibodies for 2 h at room temperature. Alexa Fluor 488-conjugated donkey anti-mouse IgG (1:500 dilution; Thermo Fisher, A21202), Alexa Fluor 647-conjugated donkey anti-rabbit IgG (1:500 dilution; Thermo Fisher, A31573) and Alexa Fluor 647-conjugated donkey anti-rat IgG (1:500 dilution; Thermo Fisher, A48272) were used as secondary antibodies. Images were acquired using a spinning disk confocal microscope (Andor, Dragonfly 200) mounted on an inverted microscope (Nikon, Eclipse Ti2) and controlled by Fusion software (Andor). Microglia in the S1 region were analyzed. Microglia morphology was manually traced, and 3D analysis (soma volume, soma roundness, branch number, maximum branch length and total branch length) was performed using Neurolucida software (MBF Bioscience). Roundness was defined as (4 × a / π) / b², where a is the soma area and b is the maximum diameter of the soma in each optical section. Roundness values were calculated at all z-levels per cell, and the median was used for analysis. Cells were selected from the S1 L2/3 region in a blinded manner. MATLAB (2023b) was used for statistical analysis. The number of animals is indicated in figure legends. Welch's t-test was used in Fig. Wilcoxon's rank-sum test was used in Figs. 3f,g, 6e–g,k,l,p,q and 7e. Wilcoxon's signed-rank test was used in Figs. Wilcoxon's rank-sum test combined with Holm–Bonferroni correction was used in Fig. A multiple-comparison test with Bonferroni correction was used in Fig. Dunnett's multiple-comparison test was used in Fig. 1c,g,h and Extended Data Figs. A Tukey–Kramer multiple-comparison test was used in Figs. Repeated-measures analysis of variance was used in Fig. Data inclusion/exclusion criteria are described in figure legends. Numerical data are summarized in Supplementary Table 3. Due to space limitations of the figures and figure legends, all the statistical details (sample size, P values and statistical tests used) are summarized in Supplementary Table 4. A new plasmid generated in this study (pCAG-GCaMP6f) has been deposited to Addgene (no. Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article. Raw image data used in this study has been deposited to the SSBD:repository (https://doi.org/10.24631/ssbd.repos.2025.11.484)76. Detailed protocols and technical tips are described in SeeDB Resources (https://sites.google.com/site/seedbresources/). Requests for additional program codes and data generated and/or analyzed during the current study should be directed to and will be fulfilled upon reasonable request by the corresponding author. Helmchen, F. & Denk, W. Deep tissue two-photon microscopy. Structural and molecular interrogation of intact biological systems. Dodt, H. U. et al. Ultramicroscopy: three-dimensional visualization of neuronal networks in the whole mouse brain. Erturk, A. et al. Three-dimensional imaging of solvent-cleared organs using 3DISCO. Hama, H. et al. ScaleS: an optical clearing palette for biological imaging. Scale: a chemical approach for fluorescence imaging and reconstruction of transparent mouse brain. Ke, M. T., Fujimoto, S. & Imai, T. SeeDB: a simple and morphology-preserving optical clearing agent for neuronal circuit reconstruction. Ke, M. T. et al. Super-resolution mapping of neuronal circuitry with an index-optimized clearing agent. Susaki, E. A. et al. Whole-brain imaging with single-cell resolution using chemical cocktails and computational analysis. Ueda, H. R. et al. Tissue clearing and its applications in neuroscience. Z., Tuchin, V. V. & Zhu, D. Skin optical clearing by glycerol solutions: mechanism. Cicchi, R., Pavone, F. S., Massi, D. & Sampson, D. D. Contrast and depth enhancement in two-photon microscopy of human skin by use of optical clearing agents. Wang, J., Zhang, Y., Xu, T. H., Luo, Q. M. & Zhu, D. An innovative transparent cranial window based on skull optical clearing. Zhu, D., Larin, K. V., Luo, Q. M. & Tuchin, V. V. Recent progress in tissue optical clearing. Achieving optical transparency in live animals with absorbing molecules. Feng, W., Liu, C. J., Wang, L. S. & Zhang, C. An optical clearing imaging window: realization of mouse brain imaging and manipulation through scalp and skull. Boothe, T. et al. A tunable refractive index matching medium for live imaging cells, tissues and model organisms. Sugimoto, S. & Kinjo, Y. Instantaneous Clearing of Biofilm (iCBiofilm): an optical approach to revisit bacterial and fungal biofilm imaging. Iijima, K., Oshima, T., Kawakami, R. & Nemoto, T. Optical clearing of living brains with MAGICAL to extend imaging. Arbelaez-Camargo, D. et al. Osmolality predictive models of different polymers as tools in parenteral and ophthalmic formulation development. Frye, R. M., Lees, H. & Rechnitz, G. A. Magnesium-albumin binding measurements using ion-selective membrane electrodes. Keck, C. H. C. et al. Color-neutral and reversible tissue transparency enables longitudinal deep-tissue imaging in live mice. In vivo optical clearing of mammalian brain. Sakaue-Sawano, A., Kobayashi, T., Ohtawa, K. & Miyawaki, A. Drug-induced cell cycle modulation leading to cell-cycle arrest, nuclear mis-segregation, or endoreplication. Tan, J. et al. Limited oxygen in standard cell culture alters metabolism and function of differentiated cells. Eiraku, M. et al. Self-organizing optic-cup morphogenesis in three-dimensional culture. Shadow imaging for panoptical visualization of brain tissue in vivo. Tonnesen, J., Inavalli, V. V. G. K. & Nägerl, U. V. Super-resolution imaging of the extracellular space in living brain tissue. Dense 4D nanoscale reconstruction of living brain tissue. Fujimoto, S. et al. Activity-dependent local protection and lateral inhibition control synaptic competition in developing mitral cells in mice. Sustained deep-tissue voltage recording using a fast indicator evolved for two-photon microscopy. Manita, S., Shigetomi, E., Bito, H., Koizumi, S. & Kitamura, K. In vivo wide-field and two-photon calcium imaging from a mouse using a large cranial window. Sensitivity optimization of a rhodopsin-based fluorescent voltage indicator. & Economo, M. N. High-speed multiplane confocal microscopy for voltage imaging in densely labeled neuronal populations. Large-scale deep tissue voltage imaging with targeted-illumination confocal microscopy. Chong, E. et al. Manipulating synthetic optogenetic odors reveals the coding logic of olfactory perception. Spors, H. & Grinvald, A. Spatio-temporal dynamics of odor representations in the mammalian olfactory bulb. Measuring the olfactory bulb input-output transformation reveals a contribution to the perception of odorant concentration invariance. Schoppa, N. E. & Westbrook, G. L. Glomerulus-specific synchronization of mitral cells in the olfactory bulb. & Rinberg, D. Precise olfactory responses tile the sniff cycle. Iwata, R., Kiyonari, H. & Imai, T. Mechanosensory-based phase coding of odor identity in the olfactory bulb. High-speed, cortex-wide volumetric recording of neuroactivity at cellular resolution using light beads microscopy. Ota, K. et al. Fast, cell-resolution, contiguous-wide two-photon imaging to reveal functional network architectures across multi-modal cortical areas. Yu, C. H., Stirman, J. N., Yu, Y. Y., Hira, R. & Smith, S. L. Diesel2p mesoscope with dual independent scan engines for flexible capture of dynamics in distributed neural circuitry. & Svoboda, K. A large field of view two-photon mesoscope with subcellular resolution for in vivo imaging. Lim, D., Chu, K. K. & Mertz, J. Wide-field fluorescence sectioning with hybrid speckle and uniform-illumination microscopy. Yokoyama, T. et al. A multicolor suite for deciphering population coding of calcium and cAMP in vivo. Wichmann, T. O., Damkier, H. H. & Pedersen, M. A brief overview of the cerebrospinal fluid system and its implications for brain and spinal cord diseases. & Hell, S. W. 2,2′-Thiodiethanol: a new water soluble mounting medium for high resolution optical microscopy. Wang, B. S., Sarnaik, R. & Cang, J. H. Critical period plasticity matches binocular orientation preference in the visual cortex. Dana, H. et al. Thy1-GCaMP6 transgenic mice for neuronal population in vivo. Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Swindells, J. F., Snyder, C., Hardy, R. C. & Golden, P. Viscosities of Sucrose Solutions at Various Temperatures: Tables of Recalculated Values, Vol. Stringer, C., Wang, T., Michaelos, M. & Pachitariu, M. Cellpose: a generalist algorithm for cellular segmentation. Pachitariu, M. & Stringer, C. Cellpose 2.0: how to train your own model. Eiraku, M. et al. Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. & Hirai, H. Efficient whole brain transduction by systemic infusion of minimally purified AAV-PHP.eB. Ehler, E., Moore-Morris, T. & Lange, S. Isolation and culture of neonatal mouse cardiomyocytes. Aihara, S., Fujimoto, S., Sakaguchi, R. & Imai, T. BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling. Neher, E. Correction for liquid junction potentials in patch clamp experiments. Sun, X. C. et al. Functionally distinct neuronal ensembles within the memory engram. Sato, T. K., Haider, B., Häusser, M. & Carandini, M. An excitatory basis for divisive normalization in visual cortex. Tischbirek, C. H. et al. Functional mapping of a cortical column at single-neuron resolution. Niell, C. M. & Stryker, M. P. Highly selective receptive fields in mouse visual cortex. Berg, S. et al. ilastik: interactive machine learning for (bio) image analysis. Graybuck, L. T. et al. Enhancer viruses for combinatorial cell-subclass-specific labeling. Pennington, Z. T. et al. ezTrack: an open-source video analysis pipeline for the investigation of animal behavior. Long-term imaging of experience-dependent synaptic plasticity in adult cortex. Imaging data in the paper “Isotonic and minimally invasive optical clearing media for live cell imaging ex vivo and in vivo” https://doi.org/10.24631/ssbd.repos.2025.11.484 (2025). Pertoft, H. & Laurent, T. C. Isopycnic separation of cells and cell organelles by centrifugation in modified colloidal silica gradients. in Methods of Cell Separation (ed. & Tuchin, V. A comparative study of skin optical clearing using two-photon microscopy. SPIE - The International Society for Optical Engineering Vol. SPIE - The International Society for Optical Engineering Vol. & Luo, Q. M. Imaging dermal blood flow through the intact rat skin with an optical clearing method. Choice of cranial window type for imaging affects dendritic spine turnover in the cortex. We thank H. Zeng (Allen Institute, Ai162), J. Sanes (Harvard University, Thy1-YFP-H), K. Svoboda (Allen Institute, Thy1-GCaMP6f) and E. Deneris (Case Western Reserve University, ePet-Cre) for mouse strains; A. Miyawaki (RIKEN) for cell lines (HeLa/Fucci2); M. Eiraku (Kyoto University) for embryonic stem cell lines (EB5); D. Kim & GENIE Project (Janelia Research Campus) for pGP-CMV-GCaMP6f (Addgene plasmid no. 40755); F. St-Pierre (Baylor College of Medicine) for pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE (Addgene viral prep no. 179459-AAV1); J. Wilson (University of Pennsylvania) for pENN.AAV.CamKII 0.4.Cre.SV40 (Addgene viral prep no. 105553-AAV1); GENIE Project (Janelia Research Campus) for pGP-AAV-syn-jGCaMP8m-WPRE, pGP-AAV-syn-jGCaMP8f-WPRE, pGP-pcDNA3.1 Puro-CAG-Voltron2 and pGP-pcDNA3.1 Puro-CAG-Voltron2-ST, pGP-AAV-syn-FLEX-Volton2-ST-WPRE (Addgene plasmid nos. 172907-AAV1); V. Gradinaru (California Institute of Technology) for pUCmini-iCAP-PHP.S (Addgene plasmid no. 103006); B Tasic (Allen Institute) for AiP1010-pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA (Addgene plasmid no. 163476); M -T. Ke and M. Morimoto (RIKEN) for evaluating our earlier versions of the clearing medium; S. Uchida and K. Miyamichi (RIKEN) for sharing reagents; M. Nishihara, E. Nozoe, S. Hamatake, K. Yashiro and S. -H. Chou for technical assistance. We also thank The Research Support Center, Research Center for Human Disease Modeling, Kyushu University Graduate School of Medical Sciences, which was in part supported by Mitsuaki Shiraishi Fund for Basic Medical Research. This work was supported by grants from CREST program (JPMJCR2021 to T.I. ), Kagoshima University Megumikai Medical Research Promotion Fund (to Y.T. ), World Premier International Research Center Initiative (WPI-PRIMe; to K.H. ), the Mochida Memorial Foundation for Medical and Pharmaceutical Research and the Uehara Memorial Foundation (to T.I. Shigenori Inagaki, Satoshi Fujimoto, Takahiro Noda, Hikari Takeshima, Koki Ishikawa & Takeshi Imai Department of Pharmacology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan Nathan Zechen Huynh, Yuki Kambe & Tatsuo K. Sato Rei Yagasaki, Misato Mori, Aki Teranishi & Satoru Okuda Department of Stem Cell Biology and Medicine, Graduate School of Medical Sciences, Kyushu University, Higashi-ku, Fukuoka, Japan Department of Optical Neural and Molecular Physiology, Graduate School of Biostudies, Kyoto University, Kyoto, Japan Laboratory of Optical Biomedical Science, Institute for Life and Medical Sciences, Kyoto University, Kyoto, Japan Division of Reproductive Systems, Premium Research Institute for Human Metaverse Medicine (WPI-PRIMe), Osaka University, Suita, Japan Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar performed all the experiments for screening and optimizing SeeDB-Live. performed chronic awake in vivo imaging. Correspondence to Shigenori Inagaki or Takeshi Imai. have filed a patent application related to SeeDB-Live. The other authors declare no competing interests. Nature Methods thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editor: Nina Vogt, in collaboration with the Nature Methods team. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. (b) Calcium responses of GCaMP6f-expressing HEK293T cells to 50 μM ATP, measured using a plate reader. Osmolarity was not adjusted to isotonicity (hypertonic, 300-700 mOsm/kg see also c) in this experiment. After incubation with the clearing media for 4 hours, GCaMP6f responses were measured. (c) Calcium responses of GCaMP6f-expressing HEK293T cells to 50 μM ATP in the media with variable osmolality (300-700 mOsm /kg). The osmolality was adjusted with 10x PBS. The osmolalities of high MW media are also indicated. There are several products of BSA with different grades of purity are available from different companies. The osmolality was slightly different among these products, suggesting that salts remain in some of the products. (e) Residual salts contained in BSA products #1 and #2. The amounts of Na+, K+, Ca2+ and Mg2+ in BSA powder were measured using Inductively Coupled Plasma Mass Spectrometry (ICP-MS). The Cl− amount was obtained from the product's certificate of analysis, which was measured by ion chromatography. In the preparation of SeeDB-Live, residual salts contained in the BSA powder were taken into account. (f) Transmittance of live HeLa cell suspension (4 × 106 cells/mL, transmittance at 600 nm) in isotonic BSA#1/PBS at refractive index 1.365-1.375. n = 3 each. (g) Growth ratio of HeLa/Fucci2 cells in refractive index-optimized (refractive index 1.363, 320 mOsm/kg) medium of different BSA products. Purification methods are not disclosed for most BSA products. (h) Growth curve of HeLa cells cultured in a 35 mm dish. Cell numbers in suspension was measured with a hemocytometer after trypsinization. The medium was isotonic, and their refractive indices were adjusted to 1.363. n = 3 dishes each. ; not significant (p ≥ 0.05) (Wilcoxon rank sum test corrected with Holm-Bonferroni correction). Cell number was counted based on fluorescence images of the nuclei. ***p < 0.001 (two-sided Dunnett's multiple comparison test). (j) Standard curve for the viscosity measurement using sucrose solution. Flow speed was determined using 50 mL syringes. Plot was fitted with a single-exponential curve. (k) Viscosity of candidate solutions (in ddH2O). (l) Specific gravity of the candidate solutions in PBS. The refractive indices of iodixanol and BSA#1 were 1.366. Specific gravity of cells are cited from previous studies77. (m, n) Some of the BSA products have autofluorescence signals of unknown origin, especially for UV to blue range; therefore, we carefully selected low autofluorescence and low toxicity products from multiple suppliers. Absorbance (m) and fluorescence (n) of fetal bovine albumin (FBS), iodixanol, and BSA from different manufacturers are shown. Except for FBS, they are adjusted to 15% (w/v) in ddH2O. Data with error bars indicate mean ± SD. See Supplementary Table 4 for detailed statistical data. (a, b) Spontaneous activity of mitral cells in the olfactory bulb was measured under different concentrations of divalent cations ex vivo. Amplitude (a) and frequency (b) were analyzed. Thy1-GCaMP6f mice (age, P11-14) were used for two-photon imaging of acute olfactory bulb slices. Note that the amounts of Ca2+ and Mg2+ derived from BSA products are also considered. (c, d) Spontaneous activity of mitral cells in the olfactory bulb was measured under different concentrations of Na+ and Cl⁻ ex vivo. Amplitude (c) and frequency (d) were analyzed. Thy1-GCaMP6f mice (age, P9-11) were used for two-photon imaging of acute olfactory bulb slices. A NaCl stock solution was added to adjust the concentration of Na+ and Cl⁻. Note that the amounts of Na+ and Cl⁻ derived from BSA products are also considered. There are no statistical differences in the amplitude or frequency across all conditions. However, abnormal firing (putative cortical spreading depression) was found at higher Na+ conditions (174 mM) in one trial, where the Cl⁻ concentration was matched to ACSF (134 mM). This slice was excluded in the analysis. n.s., non-significant (p ≥ 0.05) (Bonferroni-corrected pairwise comparisons).The formulation of the ACSF and the isotonic SeeDB-Live/ACSF (in mM) is as follows. See Supplementary Table 4 for detailed statistical data. Cells were cultured in SeeDB-Live medium (refractive index 1.366, 320 mOsm/kg) from DIV2 to DIV5. (b) Primary culture of cardiomyocytes before and after incubation in SeeDB-Live medium. Confocal image (top) and spontaneous calcium signals (bottom) at DIV2. (c) jGCaMP8f signals of cultured cardiomyocytes at DIV3 and DIV5. (d) Primary culture of hippocampal neurons. Neurons were cultured in SeeDB-Live medium (refractive index 1.363, 230 mOsm/kg) from DIV7 to 10. (e) jGCaMP8m signals of cultured hippocampal neurons before and after incubation in SeeDB-Live medium. (f, g) Amplitude and frequency of spontaneous calcium signals for the control (black) and SeeDB-Live (red). n.s., non-significant (two-sided Wilcoxon rank sum test). (h) Transmittance of live HeLa cell suspension (4 × 106 cells/mL) at different wavelengths was compared among PBS, SeeDB-Live/PBS, and 0.6 M tartrazine/PBS18. Due to high absorption of tartrazine, we could not compare transmission below 550 nm. (i) Phase contrast and fluorescence images of GFP-expressing HEK293T cells. The cells were immersed in Control (PBS), SeeDB-Live/PBS (refractive index 1.363, 296 mOsm/kg), and then in 0.6 M tartrazine/PBS (refractive index 1.43, 1407 mOsm/kg). (j) Phase contrast image of HeLa cells before and after immersion in 0.1 M tartrazine solution (RI 1.351), adjusted to isotonic condition (310 mOsm/kg). (k) Refractive indices, osmolalities, and transmittances (at 600 nm) were compared among clearing agents reported for live tissue 18,28. Red indicates ideal ranges for non-invasive optical clearing of live cells. Data with error bars indicate mean ± SD. (a)-(g) show data from representative samples out of 3 trials. (i) and (j) show single-trial data. See Supplementary Table 4 for detailed statistical data. (a) Growth of HeLa/Fucci2 spheroids cultured continuously in SeeDB-Live medium (refractive index 1.366, 320 mOsm/kg). Cell number in suspension was calculated with a hemocytometer after trypsinization. Half of the medium was replaced daily. 17.2% (v/v) 2,2'-thiodiethanol (TDE) in ddH2O (refractive index 1.366) was used for immersion to minimize spherical aberration. (c) Three-dimensional fluorescence images of a HeLa/Fucci2 cell spheroid in the control and SeeDB-Live media (4 hour clearing per day as shown in Fig. Fluorescence intensity indicate the mean intensity of all the cell nuclei in each z plane. 17.2% (v/v) TDE/ddH2O (refractive index 1.366) was used as immersion. (f) Responses of enteroendocrine cells to high potassium stimulation (30 mM at final concentrations). GCaMP6s signals are shown for the intestinal organoids derived from ePet-Cre; Ai162 mice (EEC-GCaMP6s). F0 (left) and ΔF/F0 (right) images (z stack: 0-186 µm) are shown. (g-j) ES cell-derived neuroepithelial organoid culture. (g) Schematic diagram of neuroepithelial organoid sample preparations. The epithelial tissue was broken with a glass capillary to facilitate clearing of the organoid with SeeDB-Live medium. 17.2% (v/v) TDE/ddH2O (refractive index 1.366) was used for immersion. (h) ES cell-derived neuroepithelial organoids (day 9). The bright field images before and after SeeDB-Live treatment. (i) 3D rendered fluorescence images of Lifeact-mCherry-expressing neuroepithelial organoid before and after SeeDB-Live treatment. A representative sample out of three with similar results. Normal (left) and SeeDB-Live medium (refractive index 1.363; right). Small incision was made in the organoid before SeeDB-Live treatment. (j) Fluorescence images of the Lifeact-mCherry-expressing neuroepithelial organoid at different depths before and after SeeDB-Live treatment. Data with error bars indicate mean ± SD. Images show representative samples out of 2-3 trials. See Supplementary Table 4 for detailed statistical data. Panels b, e and g created in BioRender. (a-c) Acute hippocampal slices cleared with SeeDB-Live. Confocal (a) and two-photon (b) images (3D rendering) of acute hippocampal slices cleared with SeeDB-Live/ACSF (refractive index 1.363, 310 mOsm/kg in ACSF). (c) Fluorescence images of the acute hippocampal slices taken at different depths using confocal (left) and two-photon microscopy (right). (d) Fluorescence images of acute brain slices from the primary somatosensory (S1) cortex at different refractive indices. (e) Two-photon shadow images at the superficial region of an acute brain slice from S1. The slice (S1 L5) was perfused with ACSF containing 40 μM Calcein. Bright signals are somata labeled with Calcein. (f, g) Fluorescence intensity from cell bodies in x-y fluorescence images of S1 L5ET neurons treated with 5% glycerol/ACSF. Acute brain slices of Thy1-EYFP-H mice (P19-21) were imaged before and after 5% glycerol/ACSF treatment (f). Mean fluorescence in ROIs are shown (g). Images show representative samples out of 2-3 trials. See Supplementary Table 4 for detailed statistical data. (a) Measurement of liquid junction potential (LJP). We inserted recording electrode filled with internal solution and reference electrode filled with 3 M KCl into internal solution, ACSF, and SeeDB-Live/ACSF sequentially while recording the potential under current-clamp mode. LJPs between internal solution and control ACSF or SeeDB-Live/ACSF were determined by the differences in potentials. (b) Infra-red differential interference contrast (IR-DIC) images of representative Layer 5 extratelencephalic-projecting (L5ET) neurons under electrophysiological recording. (c) Recorded neurons visualized by biocytin staining. (d) Current responses to the test pulse ( − 5 mV, 50 ms). (e) Additional electrophysiological properties of L5ET neurons at P15-18 recorded under ACSF and SeeDB-Live/ACSF. For example, we could easily patch sufficient number of neurons under ACSF. However, it took much longer to patch neurons under SeeDB-Live/ACSF, because neurons are invisible and difficult to find. The box plots indicate median ± interquartile range (IQR). n = 17 neurons from 4 mice and 14 neurons from 3 mice for control and SeeDB-Live, respectively. (f) AP frequency was plotted against injected current amplitude for the more mature L5ET neurons (age, P28-29). (g) Electrophysiological properties of the more mature L5ET neurons (age, P28-29). Results were compared between ACSF and SeeDB-Live/ACSF. Recorded neurons were then confirmed by biocytin staining post hoc. *p < 0.05; n.s., non-significant (Wilcoxon rank sum test). n = 13 cells from 2 mice per group (control and SeeDB-Live). (i) Recorded neurons visualized by biocytin staining. (k) AP frequency was plotted against injected current amplitude for the FS interneurons. (l) Electrophysiological properties of neurons for FS interneurons (age, P14-17). Results were compared between ACSF and SeeDB-Live/ACSF. FS interneurons were identified based on the firing properties ( ~ 100 Hz) upon current injection. Recorded neurons were then confirmed by biocytin staining post hoc. **p < 0.01; n.s., non-significant (two-tailed Wilcoxon rank sum test). n = 12 neurons from 4 mice and 9 neurons from 3 mice for the control and SeeDB-Live conditions, respectively. (m, n) Amplitude (m) and frequency (n) of spontaneous activity in the same set of mitral cells in ACSF and Iodixanol/ACSF (RI1.366). Olfactory bulb slices of Thy1-GCaMP6f mice were imaged. (o-q) (o) Spontaneous activity in the acute olfactory bulb slices was evaluated for glycerol-containing ACSF at a refractive index of 1.366. Mean amplitude (p) and frequency (q) of spontaneous activity in individual mitral cells. n = 24, 33 cells from 3 mice for ACSF and 21% Glycerol/ACSF. ***p < 0.001 (two-tailed Wilcoxon rank sum test). Data with error bars indicate mean ± SD. Images show representative samples out of 2-4 independent trials. See Supplementary Table 4 for detailed statistical data. (a) Layer 5 extratelencephalic-projecting (L5ET) neurons in the primary somatosensory cortex (S1) before and after clearing with SeeDB-Live on day 0 and 7. The S1 of a 4-month-old Thy1-EYFP-H mouse was imaged while the mouse was under anesthesia using two-photon microscopy. (b-k) Evaluation of inflammatory responses in S1 region after SeeDB-Live treatment. A large cranial window was made 10 days prior to the SeeDB-Live treatment because open skull surgery alone is known to cause transient activation of microglia82. SeeDB-Live treatment was performed for 1 hour. Mice were sacrificed 1 day after the treatment. The brain sections were 16 µm thick. (b) Frozen sections of the cerebral cortex were stained with DAPI, anti-NeuN (neuron), anti-Iba1 (microglia), anti-CD16/32 (activated microglia, M1), anti-GFAP (activated astrocyte), anti-Sox9 (astrocyte nucleus), anti-cleaved caspase-3 (apoptosis). (c) Treated and untreated areas of ACSF-HEPES or SeeDB-Live/ACSF-HEPES in the brain. A large cranial window was made only over the treated area in the right cortex. (d, e) Density of Iba1-positive microglia in ACSF-HEPES- and SeeDB-Live/ACSF-HEPES-treated mice. n = 3 mice each for treatment with ACSF-HEPES and SeeDB-Live/ACSF-HEPES. n.s., not significant (p ≥ 0.05) (two-sided Wilcoxon signed-rank test in (d), two-sided Wilcoxon rank-sum test in (e)). (f) Morphology of microglia after treatment with ACSF-HEPES or SeeDB-Live/ACSF-HEPES. (g) Evaluation of microglial morphology in ACSF-HEPES- and SeeDB-Live/ACSF-HEPES-treated mice. Microglial morphology was manually traced in 3D, and quantitative analyses (soma volume, soma roundness, branch number, maximum branch length, and total branch length) were performed. The box plots indicate median ± interquartile range (IQR). (h) Fraction of CD16/32-positive area within Iba1-positive regions (microglia activation). (i) Fraction of GFAP-positive area (astrocyte activation). (j) Density of SOX9-positive cells (all astrocytes). (k) Density of cleaved caspase-3-positive cells (apoptosis). (l) Representative images of the cerebral cortex stained with DAPI, anti-NeuN, anti-Iba, anti-CD16/32, anti-GFAP, anti-SOX9, and anti-cleaved caspase-3 after repeated SeeDB-Live/ACSF-HEPES treatment (day 0, 3, 7, 80, 100, 120, and 218). Representative results from 3 sections of a single mouse are shown. Data with error bars indicate mean ± SD. Images show representative samples out of 2-4 independent trials. See Supplementary Table 4 for detailed statistical data. (a-d) Calcium imaging of L2/3 neurons in the primary visual cortex (V1) before and after clearing with SeeDB-Live/ACSF-HEPES. Drifting gratings of various orientations were presented to anesthetized mice. (b) Basal fluorescence of Cal-520 without visual stimulation. L2/3 neurons at a depth of ~420 μm. (c, d) Responses of a representative L2/3 neuron (indicated by arrowheads in b) to visual grating stimuli before and after clearing with SeeDB-Live. (e) Preferred orientation, maximum responses (ΔF/F0), orientation selective index (OSI), and tuning width (Sigma) for the same set of L2/3 neurons (45-58 neurons in total) before (x-axis) and after (y-axis) clearing with SeeDB-Live. The comparison was performed as described previously56. The fluorescence image of cell somata at 200 μm and 564 μm depth was shown on the right, respectively. The spikes were detected at the somata of L2/3 (g) and L5 neurons (i) indicated in (f) and (h), respectively. Data in (c) and (d) indicate mean ± SD. See Supplementary Table 4 for detailed statistical data. Panels a, f and h created in BioRender. (a-c) Epifluorescence voltage imaging of the olfactory bulb slices. (a) Two-photon image identified a labeled mitral cell (z-stack; left) in acute olfactory bulb slices (P11) also shown in Fig. 6d-f. Epifluorescence of Voltron2549 (temporal median) and ROIs are shown on the right. Cell bodies, shafts of a primary dendrite, and tufted structure within a glomerulus were analyzed. Voltron2 and GCaMP6f were introduced to mitral cells by in utero electroporation. Traces from single shot images (b) and averaged images from 65 events (c) are shown. Ticks indicate the peaks of detected action potentials. (d-f) Epifluorescence voltage imaging of L2/3 neuron somata in anesthetized mice. (d) Epifluorescence images (temporal median) of L2/3 neurons in S1 labeled with Voltron2549-ST in an anesthetized mouse (P17) before and after clearing with SeeDB-Live (1 hour after clearing). (e, f) Action potentials were detected in a L2/3 neuron indicated by the arrow in (d). (g-i) Epifluorescence voltage imaging of L2/3 neuron dendrites in awake mice. (g) Dendrites of a L2/3 neuron in S1 labeled with mTurquoise2 and Voltron2549. We imaged an awake mouse (2 months old) after SeeDB-Live treatment. (i) The spikes were detected at the dendrites of an L2/3 neuron in S1 of an awake mouse indicated in (h). (a-c) is from a representative sample out of 2 slices; (d-f) is a representative sample out of 3 animals; (g-i) is from one sample. (a) Clusters (encircled by dotted lines) and subclusters (shown in different colors) of ROIs (mostly dendrites) of the mitral/tufted cells in the mouse olfactory bulb. The clusters and subclusters were defined based on voltage traces and spike synchronicity of ROIs, respectively. (b) Voltage traces of all subclusters (−ΔF/F0). Amyl acetate was diluted at 1% (v/v) in 1 mL mineral oil in a 50 mL centrifuge tube. Saturated odor vapor in the centrifuge tube was delivered to a mouse nose for 5 second at 1 L/min. Ticks indicate the detected action potentials. (c) The spike timing in each sniff/theta cycle. (d) Spike phase of each cluster against sniff-coupled theta wave before and during odor (1% amyl acetate) stimulation. Data are from a representative sample out of two animals with similar results. Time-lapse phase contrast images of HeLa/Fucci2 spheroids cleared with SeeDB-Live. Phase contrast images of HeLa/Fucci2 spheroids cleared with SeeDB-Live. Confocal images of HeLa/Fucci2 spheroids cleared with SeeDB-Live. Time-lapse transmission imaging of mouse cerebral cortex cleared with SeeDB-Live. A cortical slice (300-μm thick, P5) was cleared with SeeDB-Live. Two-photon imaging of S1 L5ET neurons in acute brain slices prepared from a Thy1-YFP-H mouse. Confocal imaging of pyramidal neurons in hippocampal CA1 in acute brain slices prepared from a Thy1-YFP-H mouse. Two-photon imaging of pyramidal cells in hippocampal CA1 in an acute brain slice prepared from a Thy1-YFP-H mouse. Ahippocampal slice (300-μm thick) from a Thy1-YFP-H mouse (P6) was imaged with two-photon microscopy. Two-photon shadow imaging of acute brain slices. A cortical slice (300-μm thick) from a wild-type mouse (P18) was perfused with 40 μM calcein solution in ACSF or SeeDB-Live. Images were taken with two-photon microscopy. An olfactory bulb slice (300-μm thick) from a Thy1-GCaMP6f mouse (P11) was imaged with two-photon microscopy. Time-lapse two-photon imaging of GCaMP6f in acute olfactory bulb slices cleared with SeeDB-Live. An acute olfactory bulb slice(P11) was imaged with two-photon microscopy at a depth of 150 μm during clearing with SeeDB-Live. An olfactory bulb slice (300-μm thick) from a Thy1-GCaMP6f mouse (P13) was imaged with confocal microscopy. Confocal Ca2+ imaging of spontaneous activity of mitral cells in an olfactory bulb slice at different depths. An olfactory bulbslice (300-μm thick) from a Thy1-GCaMP6f mouse (P5) was imaged with confocal microscopy. A Thy1-EYFP-H mouse (4-month-old) was imaged with two-photon microscopy. Laser power and photomultiplier tube gain were constant across the depths. Time-lapse two-photon imaging of mouse cerebral cortex in a live animal cleared with SeeDB-Live. L5ET neurons in S1 in a Thy1-EYFP-H mouse (4-month-old) were imaged with two-photon microscopy during clearing with SeeDB-Live. Focal depth changes when perfusion is switched from ACSF (refractive index, 1.34) to SeeDB-Live/ACSF (refractive index, 1.363). We imaged multiplez-planes, and the imaging depth was calibrated post hoc to show the same depth. Thy1-GCaMP6f mouse (4-month-old) was imaged with two-photon microscopy. An olfactory bulb slice (300-μm thick, age P11) was imaged with epifluorescence microscopy at 2 kHz. Voltron2 was introduced to mitral cells by in utero electroporation at E12, labeled with JF549. Frames with action potential events are indicated by a white circle in the upper-left corner. ROIs were manually clipped based on two-photon and epifluorescence images. Data were normalized(−ΔF/F0) from Voltron2549 in ROIs. Preparation of SeeDB-Live and other clearing media. Details for all the statistical analyses in this study. Comparison with other in vivo clearing methods18,20,27,28,78,79,80,81. We compared SeeDB-Live and other clearing agents tested in vivo based on several key factors required for live cell clearing. Transparency of live cells was evaluated based on the transmittance of HeLa cell suspension (4 × 106 cells per ml) at 600 nm. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. et al. Isotonic and minimally invasive optical clearing media for live cell imaging ex vivo and in vivo. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Provided by the Springer Nature SharedIt content-sharing initiative Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.
You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript. Atypical frontotemporal lobar degeneration with ubiquitin-positive inclusions (aFTLD-U) is neuropathologically characterized by aggregation of the FET family of proteins and clinically manifests as sporadic young-onset frontotemporal dementia. Here we describe a major risk locus on chr15q14 identified through a genome-wide association study in 59 pathologically confirmed aFTLD-U cases and 3,153 controls (lead single nucleotide polymorphism rs549846383, P = 5.85 × 10−21, odds ratio 26.7). When combined with data from 28 additional aFTLD-U cases, 3,712 controls and 3,215 individuals with other neurodegenerative diseases and by leveraging in-house and public long-read genome sequencing data from 1,715 individuals, we identified a tandem repeat expansion on the associated haplotypes in an intron of GOLGA8A. We found variation in repeat length, motif length, and motif sequence, with long CT-dimer expansions strongly associated with aFTLD-U. Although the functional consequence of this repeat remains unknown, its presence in nearly 60% of aFTLD-U cases points to a fundamental role in disease pathogenesis. Frontotemporal dementia (FTD) is a common form of early-onset dementia marked by changes in behavior, language and/or motor function. In individuals 45–64 years of age, the point prevalence varies across studies from 0.02 to 0.22 per 1,000 persons1,2. FTD is most often caused by an underlying frontotemporal lobar degeneration (FTLD), with subtypes defined on the basis of the aggregating proteins, with misfolded tau (FTLD-tau) and TAR DNA-binding protein 43 (FTLD-TDP) comprising the largest neuropathological subgroups. The remaining 5–10% of individuals with FTLD show pathological inclusions composed of all three proteins of the FET family (FTLD-FET), that is, fused in sarcoma (FUS), Ewing's sarcoma protein (EWS) and TATA-binding protein-associated factor 15 protein (TAF15)3. Genes with a causal role have been identified in FTLD-tau and FTLD-TDP, but not in FTLD-FET. Nearly all individuals with this rare disease subtype lack a family history of a similar illness. FTLD-FET can be further divided into atypical FTLD with ubiquitinated inclusions (aFTLD-U), neuronal intermediate filament inclusion body disease (NIFID) and basophilic inclusion body disease (BIBD) based on differences in the morphology, subcellular localization and anatomic distribution of FET inclusions and other aggregating proteins4,5. aFTLD-U is the most common subtype and stands out for its characteristic clinical presentation that typically afflicts individuals in the third to fifth decades with severe behavioral variant FTD (bvFTD), often with pronounced psychiatric disturbance and sparing of language and motor functions6. Based on this clinical presentation and the distinct feature of extensive caudate atrophy on magnetic resonance imaging, aFTLD-U can be suspected during a person's lifetime, but a definitive diagnosis can only be obtained using immunohistochemical analysis at autopsy (Fig. Bilateral frontal and striatal atrophy (white arrows) is observed with coronal T1-weighted fluid-attenuated inversion recovery magnetic resonance imaging (T1-FLAIR MRI) and bilateral frontal lobe glucose hypometabolism (indicated by blue and green labeled regions) is visible with [18F]-fluorodeoxyglucose positron emission tomography imaging of the brain. Marked frontal and striatal atrophy is visible macroscopically. Microscopically, pathologic inclusions in aFTLD-U are immunoreactive for FUS and TAF15. Abundant, compact neuronal cytoplasmic inclusions are observed in the superior temporal cortex (anti-FUS antibody; 1:500, 11570-1-AP, Proteintech Group) and dentate gyrus (anti-TAF15 antibody; 1:500, A300-308, Bethyl Laboratories). TAF15-immunoreactive vermiform intranuclear inclusions are regularly observed in the dentate gyrus of aFTLD-U cases. A schematic of our study is presented in Extended Data Fig. We established an international consortium to assemble a large cohort of aFTLD-U cases. We identified a major associated locus at chr15q14 using a common variant genome-wide association study (GWAS) in 59 aFTLD-U cases and 3,153 controls. We leveraged long-read genome sequencing data from more than 1,700 individuals, which led to the identification of a tandem repeat expansion in an intron of the GOLGA8A gene on two associated haplotypes, with extensive variation in repeat length, motif length and motif composition. CT-dimer-rich repeat expansions were strongly associated with aFTLD-U, while CCTT and CCCTCT expansions were also observed in the general population and did not confer aFTLD-U risk. We performed a single variant GWAS using REGENIE7 comparing 59 neuropathologically confirmed aFTLD-U cases and 3,153 controls passing quality control and identified a strongly associated locus at chr15q14 with rs549846383 as the lead variant (P = 5.85 × 10−21, odds ratio (OR) 26.7, TTTTT > TTTT indel) (Fig. This variant was one of 38 genome-wide significant variants at chr15q14 (Fig. 2b), and its minor allele was found in 49.15% (29/59) of aFTLD-U cases compared with only 1.40% (44/3,152) of controls. A similar low frequency was observed in FTLD-TDP cases (7/507; 1.38%)8. No additional loci reached genome-wide significance. a, Manhattan plot showing the result of the GWAS performed using REGENIE for aFTLD-U with a highly significant locus at chr15q14, with 38 genome-wide significant variants. b, Visualization of associated variants at chr15q14 based on the GWAS performed using REGENIE, with segmental duplications marked with gray bars. c, Schematic visualization of the chr15q14 locus, showing GOLGA8A and GOLGA8B, the haplotypes we have identified, and the variants identified by GWAS that tag those haplotypes. The segmental duplications with the highest identity are shown in orange, leading to low mappability for short-read sequencing. A frequent deletion overlapping GOLGA8A and GOLGA8B is shown with a red bar, with genomic coordinates according to the HPRC assemblies11 (chr15:34416680–34568563, data accessed through the UCSC genome browser track). d, Horizontal bar chart representing frequencies (as shown by color) and absolute number of carriers with associated haplotypes in pathologically confirmed aFTLD-U and control individuals, with individuals with missing genotypes removed. GOLGA8A and GOLGA8B are 98.9% identical, which complicates analysis using short-read sequencing because of ambiguous read alignments. In agreement with the HPRC assemblies11, we identified copy number variation (CNV) at the GOLGA8A–GOLGA8B locus but without disease association (Supplementary Note). A pangene visualization of 472 haplotypes demonstrates the existence of several configurations, with gains, losses and putative gene conversion events12 (Supplementary Fig. We next performed a conditional GWAS by excluding rs549846383 minor-allele carriers, without filtering variants on Hardy–Weinberg equilibrium (HWE) owing to the common GOLGA8A-B CNV. The top result from this analysis, comparing 30 aFTLD-U cases with 3,108 controls, highlighted an independent association signal at chr15q14 for rs148687709 (P = 3.35 × 10−5, OR 4.7) with 40.00% of the remaining cases (n = 12/30) and 5.73% (n = 178/3,108) of the remaining controls carrying the minor C-allele (Supplementary Figs. rs148687709 was also strongly associated with aFTLD-U in the original GWAS (P = 2.65 × 10−18, OR 7.11). In the overall cohort, carriers of rs549846383 form a subset of those with rs148687709, suggesting that rs148687709 tags a haplotype ancestral to the one on which rs549846383 occurred. We refer to the initially discovered haplotype tagged by the minor allele of rs549846383 as haplotype A and refer to the haplotype tagged by the minor allele of rs148687709 (with major allele of rs549846383) as haplotype B (Fig. The opposite was observed for one aFTLD-U case with a deletion, who appeared homozygous for the rare allele of rs148687709, despite being heterozygous for rs549846383, indicating a deletion of the GOLGA8A-B locus on the non-associated haplotype. To further characterize the complex chr15q14 locus, we leveraged long-read genome sequencing data from brain tissue from 283 individuals, mostly FTLD-TDP cases and controls, generated as part of ongoing projects. By chance, this cohort already included 2 haplotype A carriers (1 FTLD-TDP case and 1 control) and 14 haplotype B carriers (13 FTLD-TDP cases and 1 control) (Supplementary Table 1). We additionally performed long-read sequencing in brain tissue of 53 aFTLD-U cases (22 haplotype A, 9 haplotype B and 22 carrying neither haplotypes A or B) and 5 non-aFTLD-U individuals carrying haplotype A selected from the FTLD-TDP short-read genome sequencing cohort8 (n = 2) and the Mayo Clinic control cohort (n = 3). Using the long reads, we confirmed that rs549846383 is in cis with rs148687709. After repeat genotyping, we observed repeat length variation in the in-house long-read cohort (n = 341), with longer alleles in cis with the minor alleles of rs549846383 and rs148687709 and predominantly observed in aFTLD-U cases carrying haplotypes A and B (Fig. We validated the repeat lengths seen in long-read sequencing by Southern blotting (Supplementary Fig. b, Length consensus with the length in nucleotides of the repeat consensus sequence of the longest allele for each individual, with a horizontal line at 100 bp (the cutoff for visualizations in c and d). c, Sequence composition plot showing a heatmap of 12-mer motif frequencies, which allows representation of dimer, tetramer and hexamer motifs but does not effectively represent pentamer motifs (observed in one patient). Each row represents a unique individual with an expanded allele (≥100 bp). d, Plot generated with aSTRonaut showing the repeat sequence for all individuals with an expanded allele (≥100 bp). A dynamic version of this plot is available at https://wdecoster.github.io/chr15q14/anonymized_aSTRonaut_all.html. We additionally performed a GWAS of aFTLD-U with the length of STRs as continuous predictor variables in the long-read sequencing cohort. A total of 318,299 STR loci passed call-rate filtering, resulting in two genome-wide significant STR loci at chr15q14. We confirmed a strong association for the length of the GOLGA8A STR at chr15:34,419,425–34,419,451 (GRCh38) with aFTLD-U (P = 1.98 × 10−13, OR 17.1). The only other genome-wide significant STR locus was an intergenic repeat polymorphism between GOLGA8A and GOLGA8B at chr15:34,480,576–34,480,608, which is on average 8 bp longer on the associated haplotypes but without expanded alleles (P = 2.02 × 10−16, OR 6.2; Supplementary Fig. We further leveraged the long-read sequencing data to genotype all single nucleotide variants (SNVs) and structural variants (SVs) in a 500-kb window around the rs549846383 tagging variant in our cohort, concluding that there are no additional variants that could explain the association signal (Supplementary Note). Using a phylogenetic tree (Methods), we demonstrated that carriers of an associated haplotype cluster separately (Supplementary Fig. Encouraged by these findings, we further investigated the associated GOLGA8A tandem repeat, which is annotated as an STR with 6.75 copies of a TTTC-motif in GRCh3814. However, in our cohort, the analysis of expanded alleles identified expansions of a CT dimer, a CCTT tetramer, a CCCTCT hexamer and CCCCT pentamer motifs. Using a 12-mer heatmap, we observed that CT dimers are found exclusively on haplotypes A and B, occurring at particularly high frequencies in aFTLD-U cases (Fig. CCTT expansions are observed only in individuals without haplotype A or B, while CCCTCT hexamer expansions are found on haplotypes A and B, but more so in non-aFTLD-U individuals. Representative examples of repeat consensus sequences can be found in Supplementary Table 2. We developed six repeat-primed polymerase chain reaction (PCR) assays with primers against the observed motifs, confirming the repeat sequences observed with long-read sequencing (Supplementary Figs. We also observed several flanking motifs, which are variable in length but short (≤20 units), including tetramers (CTTT and CCCT) and a pentamer (CCTTT) (Fig. All non-aFTLD-U individuals carrying haplotype B showed a short CCCT stretch flanking the 5′ end of the repeat (10–20 units), followed by a short CT stretch. We also observed mixed repeat compositions. Two aFTLD-U cases carrying haplotype B showed expanded stretches of both CT and CCCTCT. We also identified a non-aFTLD-U individual with a 12-mer repeat motif with motif interruptions at the 5′ end and a CT-dimer at the 3′ end of the repeat. Finally, we observed a highly remarkable CnT-rich allele in a case with haplotype B for which no clear repeat motif could be described. The repeat consensus sequence had up to 62 consecutive Cs, flanked by shorter CT-dimer stretches at the expansion ends. Although the observed long C homopolymer stretches require caution without orthogonal validation, it is noteworthy that this case was the only one with a positive family history of aFTLD-U. Unfortunately, no DNA was available from the affected mother15. Based on these observations, we hypothesized that long expansions predominantly composed of CT dimers drive aFTLD-U risk. In particular, of the seven non-aFTLD-U individuals with haplotype A, one had a CCCTCT hexamer repeat composition, one had a 12-mer repeat and five had CT-rich repeat lengths ranging from only 149 bp up to 1,178 bp (median 433 bp; 71%). For the 14 non-aFTLD-U individuals with haplotype B, we observed two carriers with a CCCTCT hexamer repeat composition (14.3%) and 12 carriers of a relatively short repeat primarily composed of CT ranging from 187 bp to 235 bp (median 214 bp; 85.7%). By contrast, for seven out of nine aFTLD-U cases carrying haplotype B, we found long expansions predominantly composed of CT-dimer motifs (77.8%), with lengths ranging from 484 bp to 1,245 bp (median 834 bp). The exceptions were the aFTLD-U case with the CnT-rich sequence described above and one aFTLD-U case carrying haplotype B with a short CT expansion reminiscent of those observed in non-aFTLD-U individuals (presumably with a disease etiology different than chr15q14). Next, we confirmed the low frequency of the haplotype-tagging variants in non-aFTLD-U by screening additional cohorts of other neurodegenerative disease cases and controls, and we selected an additional 12 haplotype A and 18 haplotype B carriers for detailed long-read sequencing analysis16,17,18,19,20,21,22,23 (Supplementary Fig. Among the 12 haplotype A carriers, 2 individuals had no expansion (16.7%) and 3 had a hexamer motif expansion (25%), whereas the other 7 had CT-rich expansions that were relatively short in 2 individuals (137 bp and 159 bp, 16.7%) and longer in the other 5 (325–940 bp, 41.7%). Immunohistochemical analyses confirmed the absence of FUS and TAF15 pathology in non-aFTLD-U individuals with a CT-rich expansion (Supplementary Fig. Among the 18 haplotype B carriers, 16 had CT repeats (88.9%), but the repeat was much shorter than in aFTLD-U cases in all of them, with a mean expansion length of 211 bp and a maximum length of 261 bp. Two haplotype B carriers (11.1%) had a CCCTCT hexamer expansion. Similar to what we observed for a subset of non-aFTLD-U haplotype A carriers, we expected to find non-aFTLD-U individuals with haplotype B carrying longer CT expansions in rare instances, suggesting that we had not sequenced sufficient haplotypes to observe these. We thus enriched for such carriers by using repeat-primed PCR for the CT motif on all 60 Mayo Clinic controls carrying haplotype B, and selecting 3 individuals with positive signals on one or both sides of the repeat, comparable to what is observed in most aFTLD-U cases with a GOLGA8A expansion. Long-read sequencing in these individuals identified longer CT-rich expansions in two (438 bp and 736 bp), with the third control having only a short CT-rich expansion (218 bp). This confirms that a subset of the non-aFTLD-U individuals carrying haplotype A or B may carry long CT-rich repeat expansions comparable to aFTLD-U cases. Across all cohorts, long-read sequencing data was available for 19 non-aFTLD-U and 22 aFTLD-U haplotype A carriers and for 35 non-aFTLD-U and 9 aFTLD-U haplotype B carriers. The repeat genotypes of all 1,715 individuals for which long-read sequencing data are available are summarized in Fig. Repeat characteristics of all haplotype A and B carriers are summarized in Supplementary Table 3. a, Scatter plot showing the repeat genotype as the percentage CT (x axis) and the consensus repeat length (y axis, with a minimum of 20 bp), with the cohort as color and haplotype as a symbol. A dotted-line box at 450 bp and 80% CT indicates proposed patient classification cutoffs. A peak of expansions at 50% CT can be seen, corresponding to expansions with the CCTT motif composition. Notable aFTLD-U outliers are indicated with an arrow, that is, the CnT-rich haplotype B carrier (blue arrow) and the haplotype A carrier with the CCCCT pentamer expansion (green arrow). b, Strip plot representing the number of CT dimer units, counted after removing all other CT-containing motifs from the repeat consensus sequence. c, Stacked horizontal bar plots of observed repeats and their frequencies (as shown by color coding) and absolute number of carriers in aFTLD-U cases and non-aFTLD-U individuals. Three possible classifications are shown depending on CT-dimer length and percentage CT content. CT repeats not matching these criteria are shown in light pink (short CT repeat) in the latter two classifications. Based on the current in-house and public data, we propose that a repeat expansion of >450 bp and >80% CT content predicts aFTLD-U cases among haplotype carriers, with a precision of 0.80 (95% confidence interval (CI) 0.64–0.91) and recall of 0.90 (95% CI 0.75–0.97) (Fig. With an alternative classification, using a threshold of 190 CT-dimer motifs in haplotype carriers (after subtracting other repeat motifs; Methods) (Fig. The P values are 7.29 × 10−25 based on rs549846383 (tagging haplotype A), 2.01 × 10−29 based on rs148687709 (tagging haplotype A and B), 5.77 × 10−40 for the classification using the double cutoff of >450-bp expansion with >80% CT content, and 4.86 × 10−41 for the classification based on expansion alleles with >190 CT-dimer motifs. Additional screening of future cohorts is expected to further refine these cutoffs. DNA samples could be collected from five unaffected relatives from three aFTLD-U cases carrying the GOLGA8A expansion (Fig. The associated haplotype was present in two unaffected relatives. Long-read sequencing showed that the repeat expansion was similar in size and composition in each family's affected and unaffected sibling (Fig. Ultralong nanopore genome sequencing was further performed with DNA extracted from lymphoblastoid cell line (LCL) samples for the sib pair from FAM1, followed by de novo assembly and SV calling without identifying additional variation in the associated locus. From the 1000 Genomes Project cohort (FAM4), we identified one individual (HG01512) with a 804-bp pure CT expansion whose daughter (HG01514) inherited the associated haplotype. Long-read sequencing showed that repeat allele was inherited without substantial further expansion (a 907-bp pure CT expansion; Fig. a, Pedigrees of cases and control individuals from the 1000 Genomes Project carrying an expansion for which DNA of relatives could be collected. Cases diagnosed with pathologically confirmed aFTLD-U are indicated with a black shape, and the determined chr15q14 haplotype (A, B or –/none) is shown below the symbol, where DNA was available. Individuals are labeled at the top right with numbers per family. Note that FAM2.2 was lost to follow-up around the age at onset of the affected relative with current disease status unknown, and no DNA was available from the affected mother. b, Comparison of the repeat consensus sequence among family members. The consensus sequences for FAM1 family members were generated from LCL-derived DNA; for FAM2, data for the affected brother were from brain-derived DNA, while DNA from the unaffected sister was obtained from blood. Both DNA samples used for FAM4 are extracted from LCLs. We also observed considerable somatic repeat length variation with rare outliers, in agreement with the smear on the Southern blot (Fig. Visualization of individual reads shows that most of the somatic length differences are in the CT tract (Supplementary Fig. Increased somatic variation, quantified as the standard deviation of repeat length, is observed for longer repeat consensus lengths and not confined to carriers of the associated haplotypes (Supplementary Fig. For a small set of cases, we additionally sequenced DNA extracted from other tissues, such as the cerebellum, caudate and occipital cortex, and LCL cultures, again identifying variation in repeat length (Supplementary Fig. We did not observe a correlation between repeat lengths and age in aFTLD-U cases (Fig. a, Strip plot showing, for each horizontal trace, the length per read for all individuals from the in-house and public long-read cohort, including every individual for whom the consensus allele is at least 100 bp. Each dot is an individual read and, thus, a separate observation. The frequency of in-house non-aFTLD-U individuals with an expansion does not represent the general population, as we enriched explicitly for those in our sequencing efforts. b, Scatter plot showing the correlation of the number of CT dimer units with age at death for aFTLD-U patients for DNA extracted from the frontal cortex. We observed a nominally significant difference in age at death (P = 0.043; Fig. 7a) between aFTLD-U cases carrying haplotype A or B and those without association to chr15q14, with a subset of those without the haplotype showing an earlier age at death. In accordance with the distribution in the whole aFTLD-U cohort (Methods), haplotype carriers also show a sex imbalance, with 71% male and 29% female cases (Fig. a, Comparison of age at death. Two-sided t-test between haplotype A or B carriers and those without haplotypes A or B (none): P = 0.043. The aFTLD-U case carrying haplotype B but no GOLGA8A expansion, as determined by long-read sequencing, is in gray. b, Comparison of sex at birth across haplotypes in aFTLD-U cases. We next screened 23 individuals with NIFID and 11 with BIBD for the presence of chr15q14 risk haplotypes, identifying only 3 NIFID with haplotype B. Long-read sequencing was performed for one of these, showing a length (221 bp) and composition of the GOLGA8A repeat highly similar to non-aFTLD-U individuals with haplotype B (short CCCT and CT stretches). FTD has a high clinical and neuropathological heterogeneity with three possible disease proteins underlying neurodegeneration24. Despite this complexity, genetic FTD risk factors were successfully identified in recent studies owing to adequate patient stratification based on neuropathological classification25,26. In the present study, we collected a large cohort of pathologically confirmed aFTLD-U cases for genetic analysis and identified a locus on chr15q14 with 38 variants reaching genome-wide significance. Within this locus, which is characterized by a highly similar and copy-number-variable segmental duplication, we identified two haplotypes associated with aFTLD-U. SNVs tagging these haplotypes were present in nearly 60% of the aFTLD-U cohort, with a notably high OR estimate of 27. Based on long-read sequencing data of >1,700 individuals including aFTLD-U cases, individuals with other neurodegenerative disorders and neurologically healthy controls (Supplementary Table 1), we identified and characterized a STR in an intron of GOLGA8A, in cis with the haplotype-tagging variants. An increased repeat length and a motif composition with a high CT-dimer content were highly predictive of aFTLD-U and more specific than the tagging variants identified by GWAS. Interestingly, and distinct from other repeat expansion disorders, the GOLGA8A repeat is characterized by a degenerate motif, showing dimer, tetramer, pentamer and hexamer motifs composed of C and T nucleotides, of which some were found to expand and others were flanking the expansion and remained stable in size. We also observed a nearly pure C repeat in the only known inherited case of aFTLD-U, the relevance of which to disease may be clarified in future functional studies. We further observed motif length switches and hybrid compositions within the same repeat allele for which the pathogenic role requires further observations in additional cases and/or controls. Variation in repeat motif composition in disease-associated repeats has been described before, typically involving pentamer repeat motifs, where only specific motifs are pathogenic if expanded27. However, the GOLGA8A repeat is unparalleled in the variation in repeat length, motif length and motif sequence. From our collective data, we gathered evidence that long expansions composed of CT dimers are the most likely functional variant underlying disease risk in this locus. First, a detailed analysis of STRs, SVs and SNVs showed no variant that better distinguishes aFTLD-U cases from non-aFTLD-U individuals than the haplotypes A and B tagging variants (rs549846383 and rs148687709). Moreover, GOLGA8A repeat expansions of >450 bp and >80% CT content or expansions of >190 CT dimer units showed stronger association with aFTLD-U than the individual haplotype tagging variants. The fact that we observed distinct repeat patterns in the form of CT dimers only on the associated haplotypes, with a clear separation in repeat size between affected and unaffected carriers, further strengthened our findings. That said, based on the available data, we cannot exclude the possibility that other variants on the associated haplotypes contribute to disease risk. Considerable cell-to-cell somatic variation in terms of repeat length was also observed with most of the variation in the length of the CT-dimer stretches, again pointing to the instability of this specific motif. In Huntington's disease, recent work proposed that expansions in individual neurons may remain innocuous during decades of somatic expansion until they reach a length threshold that confers toxicity and triggers cell death, thus suggesting an active contribution of somatic expansion to disease onset28. While somatic expansion could similarly contribute to aFTLD-U, future studies will be required to address this question by linking repeat size and composition in individual neurons to a functional readout. It is also possible that the cells in which the repeat expanded most are no longer present at autopsy. The fact that we did observe expansions in blood-derived LCLs from several individuals indicates that the expansions are not brain specific. Yet, the range of somatic variation across tissues remains to be evaluated. About 70 repeat expansion diseases are currently described, most leading to neurological or neuromuscular disorders29,30. Various mechanisms have been ascribed to these repeat expansions, mainly depending on the location of the repeat relative to an expressed gene, including regulatory effects due to hypermethylation and thus gene silencing, formation of RNA foci often resulting from bidirectional transcription, generation of misfolded proteins for exonic repeats, and repeat-associated non-ATG translation leading to peptide-repeats in multiple reading frames. Importantly, it has been shown that these mutational mechanisms are not mutually exclusive30. The aFTLD-U repeat identified in this study is located in an intron of GOLGA8A, a gene ubiquitously expressed across organs and tissues, including in the cell types of the brain, with the highest expression in neurons and oligodendrocyte precursor cells (Human Protein Atlas). Transcripts with the expansion could be generated and contribute to disease; however, their identification is challenged by the complex genomic structure of GOLGA8A with strong homology to other GOLGA gene family members and CNV in the locus. For the same reason, GOLGA8A gene expression studies are difficult to interpret. While GOLGA8A locus deletions in the general population suggest that loss of GOLGA8A expression is not the primary driver of disease, we cannot exclude potential misregulation of the GOLGA8 gene cluster. Importantly, the specific association with CT-dimer expansions, with no risk associated with CCTT tetramers or CCCTCT hexamers, may point to sequence-specific interactions of the expanded DNA or RNA molecules with other nucleic acids or proteins. Given that this pathological repeat expansion is predominantly composed of a dinucleotide motif, novel mechanisms not previously associated with repeat expansion disorders may also be involved. Genetic studies in most neurodegenerative diseases have revealed highly penetrant monogenic causes in families and genetic risk factors with weak effect sizes in sporadic cases. While familial gene mutations have occasionally been identified in apparently sporadic cases, the identification of a highly potent risk variant for a disease typically considered sporadic raises the question of why disease segregation is not observed in families. A sporadic appearance would be expected if the repeat expanded de novo in cases, as reported for example for some sporadic neuronal intranuclear inclusion disease cases carrying the GGC repeat in NOTCH2NLC31. However, for the GOLGA8A repeat identified here, it appears the expansions can be inherited, as demonstrated by their presence in non-aFTLD-U individuals, including unaffected relatives of aFTLD-U cases. It is also possible that additional genetic variants are required to develop the disease; however, some degree of familial aggregation would be expected, thus pointing to environmental influences as the most likely contributing factor. Outside the neurodegenerative disease field, there are some notable examples of this, including Moyamoya disease, a rare cerebrovascular disorder, where immune-related responses are thought to interact with a major primary risk variant to induce disease onset32. Of particular note is the strong sex bias observed in aFTLD-U cases, with approximately 70% being male, suggesting that sex hormones or intrinsic differences in immune responses between males and females may influence disease penetrance. Finally, repeat expansions at the GOLGA8A locus were excluded in 40% of aFTLD-U cases, emphasizing genetic heterogeneity even among neuropathologically indistinguishable phenotypes. As a group, the repeat-negative cases presented with slightly earlier ages at death compared with repeat expansion carriers, with seven cases succumbing before the age of 40, raising the question of what underlies the disease in these individuals. It remains possible that aFTLD-U cases without the chr15q14 risk haplotypes carry comparable expansions at a different genomic locus, similar to what is observed for familial adult myoclonus epilepsy, where TTTCA and TTTTA repeats have been identified in at least six genes33. Analogously, a CT-rich repeat expansion anywhere in the genome could function as a prerequisite to developing disease symptoms. In fact, while its origin is unclear, the shared male predominance across 15q14 risk haplotype and nonrisk haplotype carriers could indicate a common underlying disease mechanism. However, unlike familial adult myoclonus epilepsy, the lack of familial aggregation of aFTLD-U combined with the possibility that only one or few cases would have expansions at the same genomic location severely complicates detection of such additional loci. Finally, the GOLGA8A repeat was also not associated with NIFID or BIBD, the two other FTLD-FET neuropathological subtypes. These observations are in line with the identification of distinct genetic risk factors for each of the FTLD pathological subtypes, emphasizing the crucial role of investigating phenotypic subsets26. Genetic studies focused on gene discovery may become feasible in larger cohorts of NIFID and BIBD cases in the future. Genotyping the haplotype-tagging variants and GOLGA8A repeat in individuals with early-onset behavioral symptoms may have diagnostic value for bvFTD and could aid in better classifying pathological subtypes of FTD during life. Further investigation of the downstream consequences of this unusual repeat may provide insight into aFTLD-U disease etiology and identify molecular targets for therapeutic intervention. We established an international consortium to identify and bring together a sufficiently large case population to systematically assess this group of rare disorders. FTLD-FET patients were identified through inquiries at brain banks focused on neurodegenerative disease research and by contacting authors of relevant publications. All patients or their next of kin provided consent to participate in research studies in accordance with the Declaration of Helsinki and local ethics review board standards at each of the participating sites. Our primary goal was to identify aFTLD-U cases; however, small numbers of NIFID (n = 33) and BIBD (n = 12) cases were identified and collected during these efforts (Supplementary Table 4). An experienced neuropathologist from one of the collaborating sites analyzed paraffin-embedded tissue sections for each patient to confirm the neuropathological diagnosis. As our genetic studies primarily focused on aFTLD-U, the patient characterizations were focused on differentiating aFTLD-U from the other FTLD-FET diagnoses. Specifically, aFTLD-U was diagnosed based on the presence of tau- and TDP-43-negative, FUS-positive neuronal cytoplasmic inclusions (NCI) and FUS-positive neuronal intranuclear inclusions (NII). FUS immunostaining was performed at most sites using primary antibodies 11570-1-AP (Proteintech Group) and/or HPA008784 (Sigma Life Sciences), and occasionally A300-302A (Bethyl Laboratories) or aa1-50 (Novus). None of the aFTLD-U cases showed basophilic inclusions (characteristic of BIBD) or other cellular inclusions, such as hyaline conglomerate inclusions (typical of NIFID), on hematoxylin and eosin staining. The diagnosis of aFTLD-U was further supported by the presence of only limited FUS pathology in subcortical regions and limited variability in the morphology of NCIs. In those cases where a differential diagnosis of NIFID was considered, neurofilament or alpha-internexin (AIN) immunohistochemistry was performed to exclude a pathological diagnosis of NIFID. In a minority of aFTLD-U cases, TAF15 immunohistochemistry (A300-308, Bethyl Laboratories) was also performed, confirming TAF15 immunoreactivity (of the inclusions). So far, our collective efforts have identified 108 aFTLD-U cases from 24 sites, and new cases are being added regularly. All cases were self-reported Caucasian except for one aFTLD-U case of Asian ancestry. For a small subset of aFTLD-U cases, multiple brain regions and LCLs generated by Epstein-Barr virus transformation were available. Only fixed tissue was available for the remaining 20 aFTLD-U cases. Inquiry at participating sites also identified a source of DNA (blood or LCL) from five relatives (four siblings and one child) related to three different aFTLD-U cases. These included an in-house cohort of FTLD-TDP cases and controls previously included in long-read sequencing projects, a Mayo Clinic control population including both neuropathologically confirmed normal individuals as well as a clinical cohort of neurologically healthy controls, a cohort of patients with other neurodegenerative diseases (progressive supranuclear palsy, Lewy body dementia and multiple system atrophy) from the Mayo Clinic brain bank (Mayo non-aFTLD-U), Alzheimer's disease cases and controls from the European Alzheimer's Disease DNA BioBank (EADB), and individuals from the Oxford Nanopore Technologies (ONT) 1000 Genomes Project19,20,22. From the cohort of the ONT 1000 Genomes Project, we identified one repeat expansion carrier who passed on haplotype A to his daughter, for whom only short-read sequencing data was available. We requested an LCL sample from the daughter from the Coriell biobank for long-read sequencing. The Belgian EADB cohort includes Alzheimer's disease cases ascertained at the Memory and Neurology Clinics of the BELNEU consortium, and cognitively healthy control individuals who were partners of patients or volunteers from the Belgian community23. All control individuals scored >25 on the Montreal Cognitive Assessment test and were negative for subjective memory complaints, neurological or psychiatric antecedents, and family history of neurodegeneration. All participants and/or their legal guardian signed written informed consent forms before inclusion. Genotyping was performed using the Illumina Infinium Global Screening Array (GSA, GSAsharedCUSTOM_24 + v1.0). Details on quality control, variant calling and imputation have been described in detail by Bellenguez et al.18. DNA samples from 23 aFTLD-U cases and 1,304 neurologically normal controls were sequenced using short-read genome sequencing (phase I) as part of efforts related to the International FTLD-TDP whole-genome sequencing consortium8,26. In brief, DNA from 982 control participants from the Mayo Clinic Biobank were sequenced at HudsonAlpha using the standard library preparation protocol using NEBNext DNA Library Prep Master Mix Set for Illumina (New England BioLabs) on Illumina's HiSeq X. Before analysis, participants from this cohort with possible clinical diagnosis or family history of a neurodegenerative disorder were removed (n = 144 removed; n = 838 remaining). Whole-genome sequencing for the 23 aFTLD-U cases was performed at the USUHS Sequencing Center, and 322 controls free of neurodegenerative disorders were sequenced at Mayo Clinic Rochester using the TruSeq DNA PCR-Free Library Preparation Kit (Illumina), followed by sequencing on Illumina's HiSeq X. In a next phase, genome sequencing of 38 newly ascertained aFTLD-U cases (phase II) was performed at Mayo Clinic Rochester using the Nextera DNA Flex Library prep kit followed by sequencing on Illumina NovaSeq. To enhance our study, we further incorporated genomic variant call format (gVCF) files from 2,037 control individuals obtained from the Alzheimer's Disease Sequencing Project (ADSP). gVCF enables joint genotyping with the existing cohort, as those files provide a comprehensive record of variant calls and reference positions. The gVCF files from ADSP controls were merged with our cohort's gVCF files using the joint-genotyping approach implemented with the Genome Analysis Toolkit (GATK). By merging these gVCFs, we ensured all our patients and controls were analyzed together, allowing a more robust comparison and reducing batch effects. For all cases and all controls except those from ADSP, fastq files were processed through the Mayo Genome GPS v4.0 pipeline. Variant calling was performed using GATK HaplotypeCaller followed by variant recalibration (VQSR) according to the GATK best practices35. Variant calling on the final dataset for analysis included the gVCF from 2,037 ADSP control individuals to allow joint genotyping of all cases and controls. No pathogenic variants in genes linked with neurodegenerative disorders were identified in the aFTLD-U cohort based on genome sequencing and repeat-primed PCR for the C9orf72 repeat expansion36. Mutations in the coding exons of FUS and TAF15 were excluded by Sanger sequencing in patients for whom no genome sequencing data were generated. Samples with less than 30× coverage in more than 50% of the genome, call rate below 85%, sex error, or contamination defined by a FREEMIX score above 4 were removed. After joint genotyping of all samples, relatedness was assessed using KING37, duplicates were removed and only one individual per family (second-degree relatives or closer) was kept. Individuals with <70% European ancestry based on Admixture analysis were removed38. In the aFTLD-U cohort, one case had too low coverage and one Asian case failed ancestry quality control. In total, 59 aFTLD-U cases and 3,153 control individuals passing all quality control measures were included in the analysis (Fig. Genotype calls with genotype quality <20 and/or depth <10 were set to missing, and variants with overall call rate <80% were removed. Gene annotation of variants was performed using ANNOVAR (version2016Feb01). Before running genetic association analyses, principal component (PC) analysis was performed using a subset of variants meeting the following criteria: minor allele frequency >5% and full-sample HWE P > 1 × 10−5. Influential regions such as the HLA region were removed, and variants were pruned by linkage disequilibrium with an r2 threshold of 0.1. GWAS was performed using REGENIE7, including SNVs with minor allele frequency >0.01 in cases or controls and HWE P > 1.0 × 10−6 in controls. Only variants that passed VQSR filter and with a call rate >90% in both cases and controls were included in the analyses. Batch effect tests were performed separately for controls (analysis of variance, P < 0.01) and cases (Fisher exact test, due to smaller groups), comparing genotype distributions and removing any variant with genotype frequency differences between batches in either cases or controls (P < 0.01). For all remaining 6.9 M variants, the association of genotypes with the case/control status was assessed using REGENIE with allele dosage as the predictor assuming log-additive allele effects. We additionally performed a conditional GWAS analysis after removing carriers of the rs549846383 rare allele, applying the same filters described above but without filtering for HWE, testing for association in 7.4 M variants. A separate cluster of control individuals was identified in the PC plot (Supplementary Fig. 2), and as a sensitivity analysis, we repeated the GWAS while removing those outlier controls, defined as all individuals that are three standard deviations removed on either PC1 and PC2 from the PC center. The rs549846383 and rs148687709 haplotype tagging variants were genotyped using PCR and Sanger sequencing, with primer sequences in Supplementary Table 5. The results of rs148687709 must be interpreted as tetraploid, as no unique primers could be designed, and the paralogous sequence in GOLGA8B will also be amplified (Supplementary Fig. Sanger sequencing results were analyzed using Seqman (DNASTAR) and novoSNP40. Long-read genome sequencing on the PromethION P24 (ONT) was performed for 53 aFTLD-U cases and 5 non-aFTLD-U individuals carrying haplotype A selected from FTLD-TDP short-read genome sequencing and Mayo Clinic controls. The newly generated dataset was combined with an ongoing genome sequencing initiative of 283 non-aFTLD-U individuals, mostly FTLD-TDP patients and neurologically normal controls. In a second phase, 11 non-aFTLD-U individuals were sequenced, including 8 carrying haplotype A (4 patients with progressive supranuclear palsy, 1 patient with Lewy body dementia, 1 patient with multiple system atrophy and 2 neurologically healthy controls) and 3 neurologically healthy controls carrying haplotype B. An overview of the long-read sequencing cohorts can be found in Supplementary Table 1. We additionally sequenced the genome of one NIFID patient, and sequenced other brain regions (caudate, cerebellum and occipital cortex) and LCLs for selected aFTLD-U cases, as well as LCL- and blood-derived DNA from two unaffected siblings of two aFTLD-U cases. DNA was extracted from brain tissue using the Nanobind tissue kit (PacBio) and from LCLs with the Qiagen DNA Mini Kit, followed by quality control using the Dropsense (Trinean), Qubit (Thermo Fisher Scientific) and Fragment Analyzer (Agilent) to assess purity, concentration and fragment length. DNA was sheared using the Megaruptor 3 (Hologic, Diagenode) on speed 28–30, followed by removing short fragments with the Short Read Eliminator (PacBio) when considered appropriate. The library prep was generated using the SQK-LSK110 or SQK-LSK114 kit (ONT) according to the manufacturer's instructions, except for longer incubation times for enzymatic steps, before sequencing on an R9.4.1 or R10.4.1 flow cell for 72 h. The sequencing data was base called with guppy (for R9 flowcells, v6.7.3) or dorado (for R10 flowcells, v7.1.4, v7.2.13, v7.3.11 and v7.4.13) using the high-accuracy (HAc) base calling model (ONT), including cytosine methylation and hydroxymethylation inference. The data were processed using a snakemake workflow41 (github.com/wdecoster/chr15q14). Reads were aligned to the GRCh38 reference genome (GCA_000001405.15_GRCh38_no_alt_analysis_set) with minimap2 (v2.24)42, followed by sorting reads by coordinate and conversion to CRAM format with samtools (v1.16.1)43. We performed ultralong nanopore sequencing for two participants, a sib pair sharing the haplotype with one affected and one unaffected individual (Fig. DNA was extracted from LCL pellets, following the SQK-ULK114 protocol (ONT) with sequencing on the PromethION and super accuracy base calling (dorado v7.3.11). Tandem repeats of interest were genotyped with STRdust (v0.11.7)53, either from local files as sequenced in-house or over FTP for the participants from the 1000 Genomes Project resequenced with ONT19,20,22. STRdust was used in standard (phased) mode to establish that the repeat expansion is present on the associated haplotype. As read phasing by LongShot was found to be unreliable for this locus, resulting in the omission of a large proportion of the reads from the phased results due to ambiguous alignment and uncertain haplotype assignment, the unphased mode of STRdust was used to obtain the genotypes used in this Article, determining alleles by hierarchical clustering the extracted repeat sequence for each read. STRdust generates a consensus allele by partial overlap alignment as implemented in rust-bio54, ignoring length outliers. The observed length variation suggests that the consensus sequence can change substantially due to random sampling of sequenced fragments from the library, especially at low sequencing depth. The length of all human tandem repeats55 was determined using inquiSTR (v0.13.0) (github.com/wdecoster/inquiSTR). We developed STR_regression.R (v1.6) (github.com/wdecoster/inquiSTR/scripts/STR_regression.R) for running association testing of tandem repeat lengths, which can fit generalized linear models using the output of inquiSTR repeat lengths and phenotypic information of multiple samples. Moreover, it has multiple functionalities, including different repeat length processing modes (considering either mean, minimum or maximum repeat length for a given tandem repeat), various run options (genome-wide, per chromosome and a region of interest based on a chromosomal interval or a list of regions of interest based on a BED file), and it can also take into account provided cutoffs to define expanded alleles of tandem repeats. For this analysis, we compared 52 aFTLD-U cases with 283 non-aFTLD-U individuals, excluding one Asian aFTLD-U case and the five haplotype-A-carrying non-aFTLD-U individuals specifically selected for long-read sequencing. We used the longest allele per individual for all human tandem repeats, with a binary phenotype (aFTLD-U or not), a minimal call rate of 80% and Bonferroni correction for multiple testing. The repeat composition was assessed using a k-mer heatmap, in which all 12-mers were quantified. As the CCCCT pentamer expansion was found in only a single case, the repeat composition in the cohort was quantified and visualized using the least common multiple of 12-mer units to simultaneously represent dimer, tetramer and hexamer motifs, that is, the most commonly observed motifs. VCF files were parsed with cyvcf2 (v0.30.16)56, and each 12-mer in the repeat consensus sequences was counted. After counting, all motifs were rotated and represented by the lexicographical first, then collected in a pandas dataframe57 before filtering motifs rarely observed, except if highly prevalent in one individual. We also used aSTRonaut (v1.0)53 to visualize the sequence of the observed repeat motifs per allele (CT, CCTT, CTTT, CCCT, CCCTCT, CCCCT, CCTTT and CCCCCC), replacing motifs by colored dots of the same length, substituting longer motifs first. We calculated the CT dimer count for each repeat allele by removing all occurrences of other repeat motifs in which CT is a substring (CCCTCT, CCCCT, CCTT, CCCT and CTTT) from the consensus allele and counting the remaining CT units. Precision and recall of the proposed cutoffs (>190 CT dimers or >450 bp repeat and >80% CT) was calculated using scikit-learn (v1.6.1)59 with CIs calculated using bootstrapping as implemented in scipy (v1.15.1)60. The copy number of the region between GOLGA8A and GOLGA8B (chr15:34438297–34524132), which is a unique sequence in the human reference genome, was quantified using the coverage obtained from mosdepth (v0.3.8)61, normalized to a copy-number-neutral interval (chr15:54033377–56279876) for both short- and long-read genome sequencing data. Visualization was performed in Python using Plotly (v5.14.1)58, and statistical analysis was performed for carriers of the deletion allele using a Fisher exact test as implemented in scipy (v1.15.1), comparing the deletion versus normal copy number for aFTLD-U cases against controls60. A phylogenetic tree of haplotypes in the locus of interest (defined as 500 kb surrounding the main tagging variant, chr15:34362469–34862469) was generated using the process described below. We then selected samples that were fully phased in one phaseblock for the locus of interest using phasius44, and removed samples with a copy number suggestive of a deletion or a duplication (removing samples with a normalized copy number below 0.8 or above 1.2). Subsequently, reads were tagged with the haplotype identifier (whatshap haplotag), then splitting the bam file into two haplotypes with samtools split43 (v1.13). A consensus in fasta format was generated for each haplotype using samtools consensus, for which then a multisequence alignment was generated using mafft63 (v7.526), followed by generating a phylogenetic tree with iqtree64 (v2.4.0). The obtained tree was then visualized using ggtree65 (v3.14.0). The length of the repeat expansion was confirmed with Southern blotting, using a 437-bp PCR probe, generated from genomic DNA using the PCR DIG Probe Synthesis Kit (Roche) and the following primers: forward: GGACCCTTTAGAGTTGCTTC and reverse: GTATGGAGGGCAGAGTTGTTG (corresponding to chr15:34,420,657–34,421,094). With this configuration, the expected (reference) DNA fragment size is ~4.2 kb. Genomic DNA was extracted from frontal cortex tissue, and 8 μg was digested overnight with Kpn1 and electrophoresed in a 0.8% agarose gel for 6:30 h at 100 V. The DNA was transferred to a positively charged nylon membrane (Roche) by 20-h capillary blotting and then crosslinked by ultraviolet irradiation. Prehybridization in 20 ml DIG EasyHyb solution for 3 h was followed by overnight hybridization at 47.8 °C in a shaking water bath with 30 μl of PCR-labeled probe in 7 ml of DIG EasyHyb. The membrane was washed twice in 2× standard sodium citrate, 0.1% sodium dodecyl sulfate at room temperature for 5 min each, and twice in 0.1× standard sodium citrate, 0.1% sodium dodecyl sulfate at 68 °C for 15 min each. Detection of the hybridized probe DNA was done as described in the DIG System User's Guide (Roche). CDP-star chemiluminescent substrate was used, and signals were visualized on X-ray film after 30–60 min. The ladders used are the DNA Molecular Weight Marker II with fragments at 23,130, 9,416, 6,557, 4,361, 2,322, 2,027, 564 and 125 bp, and the DNA Molecular Weight Marker VII with fragments at 8,576, 7,427, 6,106, 4,899, 3,639, 2,799, 1,953 and 1,882 bp, and nine smaller bands. A total of six primer sets were designed based on observed repeat sequences (Supplementary Table 5), in particular, to determine the presence of CT motifs on the left and right ends of the repeat, CCCTCT motifs on the left and right ends, CCCT motifs on the left, and CCCCT motifs on the left end of the repeat. The primers are used in equal proportions with amplification using the PrimeSTAR GXL DNA polymerase kit (Takara). Fragment lengths were determined with capillary electrophoresis on an ABI3730XL using an internal size standard (LIZ500HD, Thermo Fisher Scientific) and visualized using the in-house developed traci software (v1.1.0) (https://github.com/derijkp/traci). As FTLD-FET is a rare disorder, this study was made possible only through a large international collaboration. All colleagues from local sites fulfilling authorship criteria are included in the author list. Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article. Individual-level data regarding participants' phenotype and sex, their GOLGA8A repeat characteristics (length, composition, CT dimer count and so on) and the locus copy number are presented in Supplementary Table 3. A dynamic version of the ‘aSTRonaut' plot 3D is available at https://wdecoster.github.io/chr15q14/anonymized_aSTRonaut_all.html. Summary data on all tested variants of the GWAS analysis are available at https://my.locuszoom.org/gwas/943037/ and in GWAS catalog database under accession code GCST90809297. Short-read whole-genome sequencing data from 23 aFTLD-U cases and 19 controls from phase I were previously deposited in the dbGAP platform as part of the dataset with accession code phs003309 (https://www.ncbi.nlm.nih.gov/projects/gap/cgi-bin/study.cgi?study_id=phs003309.v1.p1). The dbGAP IDs of the patients included in this study are presented in Supplementary Table 6. The 19 controls can also be used for disease-specific (neurodegenerative disorders) research only. The remaining 1,285 controls from phase I are from Mayo Clinic and are not available due to data sharing constraints related to the participants' consent form. The genetic data for the 38 aFTLD-U cases from phase II are also not part of dbGAP accession phs003309 and not available due to data sharing constraints related to the participants' consent form. The gVCF genetic data from ADSP used in Phase II are available through a restricted-access policy to not-for-profit organizations; access can be obtained by applying at https://dss.niagads.org/. To reproduce the long-read data analysis and figures, all code, in the form of a snakemake workflow, Python scripts and jupyter notebooks, is available via GitHub at https://github.com/wdecoster/chr15q14. The chr15q14 repository is available via Zenodo at https://doi.org/10.5281/zenodo.17965746 (ref. STRdust is available via GitHub at https://github.com/wdecoster/STRdust, including the aSTRonaut script, and inquiSTR at https://github.com/wdecoster/inquiSTR, including the STR_regression script. Knopman, D. S. & Roberts, R. O. Estimating the number of persons with frontotemporal lobar degeneration in the US population. The prevalence and incidence of frontotemporal dementia: a systematic review. & Neumann, M. FET proteins in frontotemporal dementia and amyotrophic lateral sclerosis. Neumann, M. et al. A new subtype of frontotemporal lobar degeneration with FUS pathology. The most common type of FTLD-FUS (aFTLD-U) is associated with a distinct clinical form of frontotemporal dementia but is not related to mutations in the FUS gene. Mbatchou, J. et al. Computationally efficient whole-genome regression for quantitative and binary traits. Pottier, C. et al. Genome-wide analyses as part of the international FTLD-TDP whole-genome sequencing consortium reveals novel disease risk factors and increases support for immune dysfunction in FTLD. Antonacci, F. et al. Palindromic GOLGA8 core duplicons promote chromosome 15q13.3 microdeletion and evolutionary instability. Liao, W.-W. et al. A draft human pangenome reference. Li, H., Marin, M. & Farhat, M. R. Exploring gene content with pangene graphs. Benson, G. Tandem repeats finder: a program to analyze DNA sequences. The clinical and neuroanatomical phenotype of FUS associated frontotemporal lobar degeneration. Chia, R. et al. Genome sequencing analysis identifies new loci associated with Lewy body dementia and provides insights into its genetic architecture. Chia, R. et al. Genome sequence analyses identify novel risk loci for multiple system atrophy. Bellenguez, C. et al. New insights into the genetic etiology of Alzheimer's disease and related dementias. Noyvert, B. et al. Imputation of structural variants using a multi-ancestry long-read sequencing panel enables identification of disease associations. A. et al. High-coverage nanopore sequencing of samples from the 1000 Genomes Project to build a comprehensive catalog of human genetic variation. Byrska-Bishop, M. et al. High coverage whole genome sequencing of the expanded 1000 Genomes Project cohort including 602 trios. Structural variation in 1,019 diverse humans based on long-read sequencing. De Roeck, A. et al. An intronic VNTR affects splicing of ABCA7 and increases risk of Alzheimer's disease. & Neumann, M. Molecular neuropathology of frontotemporal dementia: insights into disease mechanisms from postmortem studies. Farrell, K. et al. Genetic, transcriptomic, histological, and biochemical analysis of progressive supranuclear palsy implicates glial activation and novel risk genes. Pottier, C. et al. Deciphering distinct genetic risk factors for FTLD-TDP pathological subtypes via whole-genome sequencing. & Friedman, J. M. Sequence composition changes in short tandem repeats: heterogeneity, detection, mechanisms and clinical implications. Handsaker, R. E. et al. Long somatic DNA-repeat expansion drives neurodegeneration in Huntington's disease. Hiatt, L. et al. STRchive: a dynamic resource detailing population-level and locus-specific insights at tandem repeat disease loci. Depienne, C. & Mandel, J.-L. 30 years of repeat expansion disorders: what have we learned and what are the remaining challenges?. Okubo, M. et al. GGC repeat expansion of NOTCH2NLC in adult patients with leukoencephalopathy. & Impens, F. Moyamoya disease emerging as an immune-related angiopathy. Corbett, M. A. et al. Genetics of familial adult myoclonus epilepsy: From linkage studies to noncoding repeat expansions. Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Robust relationship inference in genome-wide association studies. & Lange, K. Fast model-based estimation of ancestry in unrelated individuals. Boughton, A. P. et al. LocusZoom.js: interactive and embeddable visualization of genetic association study results. Weckx, S. et al. novoSNP, a novel computational tool for sequence variation discovery. Li, H. New strategies to improve minimap2 alignment accuracy. De Coster, W. & Rademakers, R. NanoPack2: Population scale evaluation of long-read sequencing data. Edge, P. & Bansal, V. Longshot enables accurate variant calling in diploid genomes from single-molecule long read sequencing. Detection of mosaic and population-level structural variants with Sniffles2. Zheng, Z. et al. Symphonizing pileup and full-alignment for deep learning-based long-read variant calling. Kolesnikov, A. et al. Local read haplotagging enables accurate long-read small variant calling. Lin, M. F. et al. GLnexus: joint variant calling for large cohort sequencing. Cheng, H., Asri, M., Lucas, J., Koren, S. & Li, H. Scalable telomere-to-telomere assembly for diploid and polyploid genomes with double graph. Heller, D. & Vingron, M. SVIM-asm: structural variant detection from haploid and diploid genome assemblies. De Coster, W. et al. Visualization and analysis of medically relevant tandem repeats in nanopore sequencing of control cohorts with pathSTR. Köster, J Rust-Bio: a fast and safe bioinformatics library. Pedersen, B. S. & Quinlan, A. R. cyvcf2: fast, flexible variant analysis with Python. Pedregosa, F. et al. Scikit-learn: machine learning in Python. Jones, E., Oliphant, T. & Peterson, P. SciPy: open source scientific tools for Python. Pedersen, B. S. & Quinlan, A. R. Mosdepth: quick coverage calculation for genomes and exomes Bioinformatics https://doi.org/10.1093/bioinformatics/btx699 (2018). Martin, M. et al. WhatsHap: fast and accurate read-based phasing. Nakamura, T., Yamada, K. D., Tomii, K. & Katoh, K. Parallelization of MAFFT for large-scale multiple sequence alignments. Minh, B. Q. et al. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Xu, S. et al. ggtree: a serialized data object for visualization of a phylogenetic tree and annotation data. This work was partly funded by the VIB (Flanders Institute for Biotechnology, Belgium) (R.R. ), the National Institutes of Health (NIH) with grants from NIA: P30AG013854 (M.M.M. ), the Robert and Arlene Kogod Center on Aging at Mayo Clinic (O.A.R. ), the Bluefield Project to Cure FTD (W.W.S. ), the Canadian Institutes of Health Research (grant 74580) (I.R.A.M.) and the G. Harry Sheppard Memorial Research Fund (E.R.). This research was supported in part by the Intramural Research Program of the US National Institutes of Health (National Institute on Aging and National Institute of Neurological Disorders and Stroke; project nos. The contributions of the NIH authors were made as part of their official duties as NIH federal employees, are in compliance with agency policy requirements, and are considered works of the US Government. Research was also supported by the Mady Browaeys Fonds voor Onderzoek naar Frontotemporale Degeneratie (R.V. )), the Sequoia Fund for Research on Aging and Mental Health KU Leuven (M.V.) and the Flanders Fund for Scientific Research (FWO): G074609 (M.V. receives a Holloway Postdoctoral Fellowship (2022-001) from the Association for Frontotemporal Degeneration (AFTD). a postdoctoral fellowship from the Brein Instituut. This study was further supported by the Rossy Family Foundation and Edmond J. Safra philanthropic fund (G.G.K. is supported by the Miriam Marks Brain Research UK Senior Fellowship and has received funding from an MRC Clinician Scientist Fellowship (MR/M008525/1) and the NIHR Rare Disease Translational Research Collaboration (BRC149/NS/MH). This work was supported by the NIHR UCL/H Biomedical Research Centre, the Leonard Wolfson Experimental Neurology Centre (LWENC) Clinical Research Facility and the UK Dementia Research Institute, which receives its funding from UK DRI Ltd, funded by the UK Medical Research Council, Alzheimer's Society and Alzheimer's Research UK (J.D.R.). Patients from Sydney were collected and processed through the Sydney Brain Bank, which is supported by Neuroscience Research Australia and a special gift from the Shaw family in memory of Jim Raftos (G.M.H.). is further supported by a National Health and Medical Research Council of Australia Senior Leadership Fellowship (1176607). Queen Square Brain Bank for Neurological Disorders is supported by Reta Lila Weston Institute and the Lille Neurobank is hosted by the Lille University Hospital (V.D.). Neuro-CEB Brain Bank is supported by patients' associations (Vaincre Alzheimer, France Parkinson, ARSLA, ARSEP, CSC, France DFT, PSP France, BRAIN-TEAM) and Assistance publique- hôpitaux de Paris (AP-HP) (S.Bo.). This work was additionally supported by a grant (EADB) from the EU Joint Programme—Neurodegenerative Disease Research (J.-C.L.). The ADSP data (NG00067) used in this study were prepared, archived and distributed by the National Institute on Aging Alzheimer's Disease Data Storage Site (NIAGADS) at the University of Pennsylvania (U24-AG041689), funded by the National Institute on Aging. This study used samples (cell lines) from the NINDS Repository. The NINDS Repository sample number used is HG01514. This study uses long-read sequencing from participants of the 1000 Genomes Project, generated at the Institute of Molecular Pathology (Vienna, Austria) with funds provided by Boehringer-Ingelheim. Wouter De Coster, Marleen Van den Broeck, Sarah Wynants, Cyril Pottier, Sara Alidadiani, Fahri Küçükali, Rafaela Policarpo, Júlia Faura, Elise Coopman, Geert Joris, Tim De Pooter, Peter De Rijk, Svenn D'Hert, Jasper Van Dongen, Julie van der Zee, Mojca Strazisar, Sebastiaan Engelborghs, Kristel Sleegers & Rosa Rademakers Wouter De Coster, Marleen Van den Broeck, Sarah Wynants, Cyril Pottier, Sara Alidadiani, Fahri Küçükali, Rafaela Policarpo, Júlia Faura, Elise Coopman, Geert Joris, Tim De Pooter, Peter De Rijk, Svenn D'Hert, Jasper Van Dongen, Julie van der Zee, Mojca Strazisar, Kristel Sleegers & Rosa Rademakers Department of Neuroscience, Mayo Clinic, Jacksonville, FL, USA Matt Baker, Nikhil B. Ghayal, Cyril Pottier, Marka van Blitterswijk, Mariely DeJesus-Hernandez, Alexandra I. Soto-Beasley, Melissa E. Murray, Nilüfer Ertekin-Taner, Lea T. Grinberg, Owen A. Ross, Dennis W. Dickson & Rosa Rademakers Department of Quantitative Health Sciences, Mayo Clinic, Rochester, MN, USA Anthony Batzler, Gregory D. Jenkins & Joanna M. Biernacka NeuroGenomics and Informatics Center, Washington University School of Medicine, St. Louis, MO, USA Biocenter, Institute of Molecular Physiology, Johannes Gutenberg-Universität, Mainz, Germany Department of Clinical Genetics, Erasmus Medical Center, Rotterdam, the Netherlands Neuropathology lab, IBB-NeuroBiobank BB1901113, Born Bunge Institute, Antwerp, Belgium Anne Sieben, Bart De Vil & Patrick Cras Department of Laboratory Medicine and Pathology, Mayo Clinic, Jacksonville, FL, USA Melissa E. Murray, Lea T. Grinberg & Dennis W. Dickson Laboratory Medicine Program & Krembil Brain Institute, University Health Network, Toronto, Ontario, Canada Shelley L. Forrest, Maria C. Tartaglia, Gabor G. Kovacs & Ekaterina Rogaeva University Health Network Memory Clinic, Krembil Brain Institute, Toronto, Ontario, Canada Claire Troakes, Istvan Bodi, Andrew King & Safa Al-Sarraj Department of Neurology, Erasmus Medical Center, Rotterdam, the Netherlands Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN, USA Queens Square Brain Bank, Institute of Neurology, UCL, London, UK Department of Neurology, UCSF Weill Institute for Neurosciences, University of California, San Francisco, San Francisco, CA, USA Alissa L. Nana, Adam L. Boxer, Salvatore Spina, Bruce L. Miller & William W. Seeley Mesulam Institute for Cognitive Neurology and Alzheimer's Disease, Northwestern University, Chicago, IL, USA Sandra Weintraub, Tamar Gefen & Marsel M. Mesulam Department of Clinical Neuropathology, King's College Hospital NHS Foundation Trust, London, UK Istvan Bodi, Andrew King & Safa Al-Sarraj Sorbonne University, APHP, Department of Neuropathology, DMU-Neuroscience, University Hospital Pitié-Salpêtrière, Institut du Cerveau - Paris Brain Institute - ICM, Inserm U1127, Paris, France Normandie Univ, Unicaen, PSL Research University, EPHE, Inserm U1077, CHU de Caen, Neuropsychologie et Imagerie de la Mémoire Humaine, and service de Neurologie, CMRR Haute Bretagne, Chu Pontchaillou, Rennes, France EunRan Suh, Gerard D. Schellenberg, Vivianna M. Van Deerlin & Edward B. Lee Neurodegenerative Diseases Research Section, National Institute of Neurological Disorders and Stroke, Bethesda, MD, USA Department of Neurology, Johns Hopkins University Medical Center, Baltimore, MD, USA Department of Anatomy, Physiology and Genetics, Uniformed Services University of the Health Sciences, Bethesda, MD, USA Neuromuscular Diseases Research Section, National Institute on Aging, Bethesda, MD, USA Computational Biology Group, Laboratory of Neurogenetics, National Institute on Aging, Bethesda, MD, USA Institute for Molecular Biology, Mainz, Germany Department of Pathology and Laboratory Medicine and Department of Neurology, Emory University, Atlanta, GA, USA Department of Pharmacology and Chemical Biology, Emory University, Atlanta, GA, USA NEUR Research Group, Center for Neurosciences (C4N), Vrije Universiteit Brussel, Brussels, Belgium Sigrun Roeber, Jochen Herms & Thomas Arzberger Department of Pathology, UCSF Weill Institute for Neurosciences, University of California, San Francisco, San Francisco, CA, USA Department of Neurology, Mayo Clinic, Jacksonville, FL, USA Nilüfer Ertekin-Taner, Zbigniew K. Wszolek, Ryan J. Uitti & Neill R. Graff-Radford Department of Neurology, Mayo Clinic, Rochester, MN, USA Wolfgang Singer, Keith A. Josephs, Ronald C. Petersen & Bradley F. Boeve German Center for Neurodegenerative Diseases (DZNE), Munich, Germany Department of Radiology, Mayo Clinic, Rochester, MN, USA Edmond J. Safra Program in Parkinson's Disease, Rossy PSP Centre and the Morton and Gloria Shulman Movement Disorders Clinic, Toronto Western Hospital, Toronto, Ontario, Canada Department of Psychiatry, Knight Alzheimer Disease Research Center, Washington University School of Medicine, St. Louis, MO, USA Sunnybrook Health Sciences Centre, Toronto, Ontario, Canada Department of Neurology, Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA German Center for Neurodegenerative Diseases (DZNE), Tübingen, Germany Department of Psychiatry & Psychology, Mayo Clinic, Rochester, MN, USA Department of Neurodegenerative Disease, Dementia Research Centre, University College London Queen Square Institute of Neurology, London, UK Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, British Columbia, Canada Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Genetic analysis and molecular biology studies: A.I.S.-B., B.J.T., C.L.D., C.P., D.D., E.C., G.D.S., G.J., J.F., J.V.D., M.B., M.D.-H., M.O.M., M.S., M.v.B., M.V.d.B., O.A.R., P.D.R., R.J.G., R.P., R.R., S.A.-S., S.D., S.H., S. Wynants, S.W.S., T.D.P., W.D.C. has received free consumables and travel reimbursement from Oxford Nanopore Technologies. are inventors on a patent filed concerning diagnostic applications of the GOLGA8A repeat expansion as described in this Article. received consulting fees from Arkuda Therapeutics. received consulting fees from Muna Therapeutics and collaborated with Novartis Pharma AG (Switzerland), and GE Healthcare (UK). holds patent EP3452830B1 for an assay for the diagnosis of a neurological disease (licensed to ADX Neurosciences NV & Euroimmun Medizinische Labordiagnostika AG). has served as a paid consultant to Alector, Alexion, Arrowhead, Arvinas, Biogen, BMS, Eli Lilly, Janssen, Merck, Neurocrine, Novartis, Oligomerix, Ono, Oscotec, Otsuka, Switch and Voyager. has also received speaking or consulting fees from Amgen, AstraZeneca, Biogen, Merck, Regenacy Pharmaceuticals, Syros Pharmaceuticals, Juvenescence Life and Souvien Therapeutics, as well as sponsored research or gift funding from AstraZeneca, JW Pharmaceuticals, Lexicon Pharmaceuticals, Vesigen Therapeutics, Compass Pathways, Atai Life Sciences and Stealth Biotherapeutics. as site PI) with Alector, AviadoBio, BMS, Denali, Eli Lilly, J&J, Merck and UCB. as DSMB or DMC member) with ACImmune and Novartis. serves as Mayo Clinic site PI on the Amylyx AMX0035-009 project and acts as an external advisory board member for the Savanna Biotherapeutics, Inc., and as a consultant for the BlueRock Therapeutics LP. The other authors declare no competing interests. Nature Genetics thanks John Landers, Po-Ru Loh and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Schematic overview of the primary analyses and results. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. De Coster, W., Van den Broeck, M., Baker, M. et al. A repeat expansion in GOLGA8A is a major risk factor for atypical frontotemporal lobar degeneration with ubiquitin-positive inclusions. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Provided by the Springer Nature SharedIt content-sharing initiative Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.
Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript. The ubiquity of C–H bonds in organic molecules makes direct C–H functionalization an atom- and step-efficient strategy in synthetic chemistry. However, direct C–H alkylation, particularly of electron-poor aromatic substrates, remains a major challenge because current methods suffer from limited selectivity, functional group tolerance and/or require harsh acidic, pyrophoric or toxic reagents. Here we introduce a selective, scalable and transition-metal-free synthetic strategy for C–H alkylation of electron-poor aromatics under mild conditions, which also exhibits high functional group tolerance applicable to the late-stage functionalization of pharmaceutical compounds. The mechanistic design exploits a redox-active phthalimide ester tag to form an electron donor–acceptor complex that fragments upon photoexcitation to yield a nucleophilic alkyl radical, which selectively alkylates the most electrophilic position of electron-deficient aromatics, thereby exhibiting ‘anti-Friedel–Crafts' selectivity. Mechanistic studies, microkinetic modelling simulations and computational analyses indicate that the reaction then propagates via radical anion autocatalysis. The ‘anti-Friedel–Crafts' selectivity is consistent with theoretical predictions from Fukui indices and machine-learning models that provide the framework necessary to forecast selectivity in previously ‘unseen' substrates, thereby enabling selective alkylation of a wide range of complex molecules and late-stage pharmaceuticals. Despite being a fundamental synthetic disconnection, methods for sp2–sp3 C–H alkylation are particularly limited for electron-deficient aromatics. Friedel–Crafts alkylation reacts preferentially with electron-rich organic aromatics1,2, and other methods for direct C–H alkylation require the use of superstoichiometric organolithium or toxic organomercury reagents (Fig. All these methods are not only limited in selectivity, but also in reaction scope due to the harsh conditions, which severely limit functional group tolerance. Classical Minisci coupling does offer a reliable radical-based route to C–H-alkylated pyridines, typically with acidic activation, but crucially has a limited C2/C4 selectivity5,6. More broadly, some Minisci-type reactions can operate without the presence of acid but remain limited to heteroaromatic alkylation7. The absence of a convenient and reliable direct C–H functionalization strategy requires the installation of a functional handle, such as a halide, followed by traditional palladium-based cross-coupling reactions or the more recently developed photoredox nickel cross-coupling (Fig. This handle reduces the atom economy of the synthesis and introduces further issues with functional group tolerance and selectivity, particularly in late-stage functionalization. The method described in the present work overcomes these issues with an autocatalytic radical mechanism triggered by a mild and targeted photoactivation of an electron donor–acceptor (EDA) complex. a, Literature strategies for the alkylation of electron-poor aromatics4,6,8,10. b, General strategy for neutral radical formation via electron donor–acceptor complex excitation and fragmentation using a redox auxiliary14,15,16. c, This work: a general metal-free, photocatalyst-free approach for sp2–sp3 coupling via an EDA complex-triggered radical mechanism propagated by radical anion autocatalysis. A, carbon or nitrogen; R, alkyl; BET, back electron transfer; SET, single-electron transfer; EWG, electron-withdrawing group; [Ox], oxidant. The generation of radical species through the photoactivation of EDA complexes has been explored since the 1950s, but it has only recently been recognized as a useful tool in organic chemistry12,13,14. Upon photoexcitation, the EDA complex undergoes single-electron transfer (SET) to form a radical ion pair, which subsequently fragments to yield the desired neutral substrate radical (S•) (Fig. EDA complexes have since been exploited in organic chemistry to enable radical formation under mild conditions, with targeted visible photoreactivity achievable through substrate design12,13,14. However, initial applications of EDA catalysis were limited to specific donor–acceptor pairs and typically required a pre-installed leaving group18,19,20. The introduction of redox auxiliaries (RAs), or ‘redox tags', as components of EDA complexes has broadened its synthetic utility and, in the presence of a donor species (D), can facilitate a charge-transfer absorption band in the visible spectrum. These auxiliaries can be attached to a specific functional group of the substrate molecule, imparting more generality to EDA methodology across a wide range of substrates15,16,17. In this Article we exploit EDA methodology to establish a general sp2–sp3 C–H coupling method that selectively alkylates the most electron-deficient position on a broad range of electron-poor aromatics (Fig. This ‘anti-Friedel–Crafts' selectivity addresses a fundamental gap in the synthetic toolbox and has been achieved by utilizing an EDA complex to trigger an autocatalytic radical reaction. This, in turn, enables the reaction to proceed under mild reaction conditions to provide tolerance of a wide range of functional groups, including halide handles, to facilitate further downstream functionalization. The high regioselectivity and functional group tolerance are demonstrated with the late-stage modification of pharmaceuticals and agrochemicals. DABCO (1,4-diazabicyclo[2.2.2]octane) and a redox-active phthalimide ester (RAE) tag form the initial EDA complex to trigger the reaction and generate alkyl radicals, which couple with a wide range of electron-poor aromatics that then serve as electron shuttles to propagate the radical reaction and enable autocatalysis. This dual utility of the aromatic coupling partner overcomes a major limitation in established EDA methodology by eliminating the reliance on either pre-functionalized substrates for intramolecular reactions or a narrow set of ‘radical traps' (for example, silyl enol ethers, isocyanides and vinyl sulfones) as coupling partners15,16,21,22,23,24. The observed ‘anti-Friedel–Crafts' regioselectivity can be readily tuned with aromatic substituents, with reactivity predictable based on density functional theory (DFT) calculations and machine-learning (ML) models developed for this study. These computational insights establish predictive design principles, further broadening the scope and applicability of the methodology. The simple reaction conditions for photoinitiated anti-Friedel–Crafts alkylation require (1) an alkyl substrate functionalized with an RAE to provide the substrate and RA, respectively, (2) a nucleophilic amine to form an EDA complex with the redox auxiliary, and (3) an aromatic sp2 coupling partner for C–H alkylation (Fig. The RAEs were readily synthesized from phthalimide and a range of carboxylic acids to serve as the electron-deficient RA component in the EDA complex. The electron-rich tertiary amine DABCO was selected as the electron donor (D) due to its known but under-utilized activation of redox-active esters (RAEs)25,26. These easily produced and inexpensive components assemble into a visible-light-absorbing EDA complex that undergo photoinduced fragmentation to generate a phthalimide anion and a neutral alkyl radical (S•), with the irreversible loss of CO2 to drive the reaction forward entropically. Phthalonitrile was selected as an example electron-deficient aromatic, which, as well as being a useful synthon in various electrochemical and photochemical transformations, can couple with the generated radical for selective anti-Friedel–Crafts alkylation (Table 1)27,28,29. The reaction thus employs inexpensive and commercially available donor species in conjunction with readily synthesized phthalimide RAEs and avoids the complex donors/acceptors employed in previous EDA methodologies15,17,23. Our standard reaction conditions were therefore as follows: DABCO (50 mol%) methylcylohexyl RAE (1, 1 equiv., 0.15 mmol scale), phthalonitrile (3 equiv.) and blue light-emitting diode (LED) irradiation (λmax = 447 nm) in dimethyl sulfoxide (DMSO) for 16 h at 25 °C under N2 (Supplementary Sections 1 and 2). These conditions enabled alkylation of phthalonitrile with methylcyclohexane at the C4 position to form the desired product, 4-(1-methylcyclohexyl)phthalonitrile (2), which was obtained in 88% assay yield and isolated in 84% yield (Table 1, entry 1). Exclusion controls confirmed the necessity of photolysis of the EDA complex, as no reaction occurred in the absence of light (Table 1, entry 2) or without the electron-rich amine donor (Table 1, entry 3). Alternative amines, such as NEt3, proceeded only with diminished yields (67%; Table 1, entry 4). Only catalytic amounts of amine are required, with no increase in yield observed with stoichiometric amounts of DABCO (87%; Table 1, entry 5). Due to the low extinction coefficient of the EDA complex, 50 mol% of the inexpensive DABCO reagent proved optimal, especially for less reactive substrates. The reaction favoured polar aprotic solvents, with DMF providing yields comparable to DMSO (83%; Table 1, entry 6), whereas protic or less polar solvents substantially reduced the yield (Supplementary Section 3). The inclusion of a prototypical iridium polypyridyl complex as a photocatalyst resulted in lower yields (71%; Table 1, entry 7), confirming the efficacy of the photocatalyst-free system based on the EDA complex. Employing the aryl radical acceptor as the limiting reagent, while having the RAE in excess, also led to a reduced yield (62%; Table 1, entry 8). Irradiation with 405-nm LEDs offered a comparable yield (83%; Table 1, entry 9), in agreement with the broad absorption band of the EDA complex (see ‘EDA fragmentation' section). The radical nature of the reaction was confirmed by the addition of a radical scavenger, TEMPO, which halted reactivity and product formation (Table 1, entry 10). Addition of an auxiliary base in the form of Cs2CO3 or potassium phthalimide to aid deprotonation resulted in yields comparable to those using standard conditions after 16 h at 25 °C (84–88%; Table 1, entries 11 and 12). However, this addition of base resulted in a substantial increase in the reaction rate, which suggests that deprotonation is the rate-limiting step of the reaction (further details are described in the ‘Mechanistic studies' section below). The generality of the anti-Friedel–Crafts alkylation was subsequently explored using various activated substrates utilizing the aforementioned standard conditions, as well as catalytic amounts of an auxiliary base, Cs2CO3 (5 mol%), to accelerate the reaction rates. The reaction proceeded effectively over a wide range of ordinarily deactivating electron-withdrawing substituents, including nitriles (2–7, 13–19 and 23, Fig. 2; for characterization see Supplementary Section 4), ketones (10 and 21), esters (11, 12 and 22), amides (46 and 47, Fig. 2), aldehydes (8, 9), a sulfone (24), as well as electron-poor heteroaromatics (13–25). Electron-poor pyridines and pyrimidines were most successful given their greater aptitude to stabilize negative charge, and therefore their respective radical anion, when compared to their aryl relatives. The reaction with electron-rich aromatics proceeded with either lower or no yields of alkylated product (28, Fig. Experimental conditions: RAE (1) = 1 equiv., 0.15 mmol; DABCO = 0.5 equiv., 75 μmol; Cs2CO3 = 0.05 equiv., 7.5 μmol; DMSO = 1 ml; aromatic acceptor (3–5 equiv. ; cflow conditions (Supplementary Section 4.3); dbatch conditions (Supplementary Section 4.4); eno Cs2CO3. A, carbon or nitrogen; NR, no reaction. Experimental conditions: RAE = 1 equiv., 0.15 mmol; 3-fluoropicolinonitrile (3–5 equiv. or for late-stage functionalization aromatic acceptor (3 equiv. Boc, tert-butyloxycarbonyl; b.r.s.m., based on recovered starting material. Crucially, the photoinitiated anti-Friedel–Crafts alkylation tolerated a wide range of halides (15 and 17–19, Fig. 2) and other transition-metal-sensitive groups (for example, methanesulfonyl and nitrile), which demonstrates the robustness of this methodology to enable downstream or late-stage functionalization. Although fluorinated and trifluorinated aromatics, common in pharmaceuticals and agrochemicals, often deactivate cross-coupling chemistry due to their electron-deficient nature30,31,32, the electron deficiency of these substrates aided the homolytic aromatic substitution in our anti-Friedel–Crafts mechanism (5, 7, 9, 15 and 16, Fig. Extremely electron-poor systems, such as nitrobenzene (26, Fig. 2) or activated pyridine N-oxides (27, Fig. 2), expectedly revealed no alkylated products, as the donor amine forms an alternative EDA complex with these substrates and outcompetes the RAE17,33,34. This confirms the suitable substrate window, with the electron-poor systems being required not to form a more favourable EDA complex than the redox auxiliary. Conversely, to prevent alkylation of the phthalimide, substrates must be better radical acceptors than the phthalimide fragment released upon RAE fragmentation. This can be observed in the absence of an alternative aromatic acceptor or when progressively more electron-rich substrates, such as anisole, are used (28) (Supplementary Section 5.1). To mitigate this competing reaction, an excess of the aromatic coupling substrate (3–5 equiv.) was employed, a strategy common in EDA methodologies using silyl enol ethers, isocyanides and other radical traps15,16,21,22,24,35. This requirement for an excess radical-accepting reagent is not prohibitive, as it can be recovered from the reaction mixture, making the method suitable for expensive or late-stage aromatic acceptor substrates, see the ‘Late-stage functionalization' section (Fig. The radical attack giving anti-Friedel–Crafts regioselectivity was highly selective in the case of aryl aromatic acceptors, with loss of yield mainly arising from alkyl radical quenching and alkylation of the phthalimide fragment of the RAE. Meanwhile, in the heteroaryl case, we observed some minor regioisomer formation, notably at the C4 position on the pyridines. The overall anti-Friedel–Crafts selectivity was retained, and total yield loss was minimized, given the electron-deficient nature of these heteroaryl species as improved acceptors for nucleophilic alkyl radicals (Supplementary Section 5.2). Our methodology operates via a ‘homolytic aromatic substitution' mechanism, in a similar fashion to a classical Minisci reaction, with nucleophilic radical attack of an electron-deficient aromatic acceptor. However, a classical Minisci reaction preferentially functionalizes heteroaromatic bases at the C2/C4 positions7, and the presence of a heteroaromatic substrate is essential in the Minisci reaction mechanistic pathway. In the case of pyridine, it is the activated pyridinium that is the aromatic acceptor, resulting in a cationic radical intermediate. In contrast, our alkylation displays ‘anti-Friedel–Crafts' selectivity, because it selectively alkylates the most electron-deficient site of neutral, electron-poor heteroaromatic and standard aromatic substrates, operating via anionic radical intermediates (Supplementary Section 5.3). ‘Anti-Friedel–Crafts' selectivity has been observed before with palladium-catalysed radical alkylation36, but our methodology exhibits substantial advantages over this precious-metal-catalysed reaction, with a substantially higher selectivity observed alongside broader functional group tolerance in milder, transition-metal-free conditions. The nucleophilic alkyl radicals generated from the RAE demonstrated exceptional scope, with tertiary, secondary and primary radicals successfully coupling with 3-fluorocyanopyridine with a wide functional group tolerance (Fig. Only formation of the methyl radical proved to be too endergonic to fragment and was hence unreactive. As expected, tertiary alkyl radicals proved the most successful, resulting in higher yields due to their nucleophilicity and stability. This provided a straightforward route to highly hindered quaternary carbon centres, common in many natural and biologically active products37. The reaction displayed tolerance to various functional groups, including ketones, aldehydes groups, alkenes, alcohols and esters. Pharmaceutically relevant motifs, such as cyclic ethers and protected amines, were also retained, making this protocol particularly suitable for the late-stage functionalization of complex substrates. The reaction is also scalable to the gram scale (Fig. 2), maintaining similar isolated yields in the alkylation of phthalonitrile from 0.15 mmol (84%) to 5 mmol (82%, 1.23 g) scales. This reaction therefore provides potential for industrial applications by using inexpensive and commercially available catalysts and proceeding through a simple one-step protocol that is scalable in both batch and flow. Building on this versatility and potential for applications, we employed this general C–H anti-Friedel–Crafts strategy to regioselectively functionalize a range of pharmaceutical and agrochemical compounds. Late-stage alkylation with N-Boc-4-methylpiperidine was selected, as piperidines are the most common nitrogen heterocycle found in drug molecules38, including the antiretroviral nevirapine (46), the fungicide boscalid (47), and the steroid biosynthesis inhibitor metyrapone (48) (in moderate yields, Fig. Notably, the excess of electron-poor aromatic radical acceptors was largely recovered, such that all pharmaceutical acceptors were purified in high yield based on recovered starting material (77–88%), thus making the use of excess reagent non-prohibitive for late-stage or expensive substrates. Furthermore, we used an RAE of gemfibrozil, a lipid-regulating fibrate, in the C–H alkylation of 3-fluoropicolinonitrile in good yield (49, 66%). This shows the ability of this methodology not only to alkylate aromatic molecules, but also to furnish carboxylic acid drug molecules with aromatic groups. These results highlight the methodology's practical applicability in the late-stage modification of biologically active compounds, thus offering a valuable tool for drug discovery. DFT calculations were performed to elucidate the mechanistic pathway for this anti-Friedel–Crafts C–H functionalization methodology (Figs. The model system (Table 1, entry 1) was selected based on its optimal reactivity, and the calculations were carried out at the ωB97XD/6-31g(d,p) level of theory (details are provided in Supplementary Sections 6.1 and 6.2). First, the EDA complexation was modelled to validate the photoinduced fragmentation that generates the initial radical species (Fig. The formation of the EDA complex from DABCO and the RAE was calculated to be reversible and slightly endergonic by +0.5 kcal mol−1 (Supplementary Section 6.3). The simulated UV–vis spectrum obtained with time-dependent DFT (TD-DFT) revealed an absorbance peak at 368 nm with a broad band that extends into the visible region, consistent with the experimental UV–vis data (see the ‘Mechanistic insights' section). Gibbs energies (in kcal mol−1), computed via DFT calculations at 298.15 K and 1 atm in DMSO, are given in parentheses (Supplementary Section 6.2). Reduction of the DABCO cationic radical is explored further in Fig. R, methylcyclohexyl; SET, single-electron transfer; BET, back electron transfer. Upon photoexcitation, an electron from the nitrogen lone pair of DABCO is promoted to the RAE's valence π* orbital. The resultant radical cation and anion pair generated can then fragment into a DABCO cationic radical, phthalimide anion, CO2 and the methylcyclohexyl radical (R•). This fragmentation is slightly endergonic, with an overall Gibbs formation energy of +3.9 kcal mol−1 (Fig. Although rapid backward electron transfer (BET) immediately after photoexcited SET can serve as a deactivation pathway, the release of CO2 gas renders the fragmentation irreversible and drives the reaction entropically forward. The alkyl radical R•, formed via the EDA fragmentation, then rapidly and selectively attacks the electron-poor aromatic phthalonitrile at the C4 site to form an aryl radical adduct (I1, ∆G = −2.7 kcal mol−1, Fig. The attack is highly selective for C4, with the alternative attack at the C3 position found to be both kinetically and thermodynamically less favoured (+0.5 and +2.5 kcal mol−1, respectively, Fig. Aryl radical adduct I1 can then proceed through either a hydrogen atom transfer (HAT) or deprotonation to yield the experimentally observed product, 4-(1-methylcyclohexyl)phthalonitrile (Fig. In the HAT pathway, hydrogen abstraction by the DABCO radical cation would lead to the final reaction product (P) in an overall exergonic process by −53.6 kcal mol−1, followed by proton exchange between the phthalimide anion and DABCO(H) to regenerate the DABCO catalyst (−61.4 kcal mol−1). However, this HAT pathway is hindered by a high energy barrier (+29.5 kcal mol−1, TSHAT), suggesting a slow reaction at 25 °C. Conversely, the deprotonation pathway whereby either DABCO or the phthalimide anion acts as a Brønsted base exhibits lower activation barriers of +9.6 and +12.3 kcal mol−1. The calculated transition state (TS) energies follow the order TSHAT > TSPT–Phtl > TSPT–DABCO (for detailed analysis and structures see Supplementary Section 6.4). Gibbs energies (in kcal mol−1), computed via DFT calculations at 298.15 K and 1 atm in DMSO, are given in parentheses (Supplementary Section 6.2). The Gibbs activation barriers, referenced to the prior lowest-energy intermediate, are shown in square brackets with a double-dagger symbol. The unpaired electron in the RAE radical anion is delocalized primarily within the five-membered ring, as indicated by the DFT Mulliken spin densities in Supplementary Fig. The low barriers of TSPT–Phtl and TSPT–DABCO mean that both deprotonation pathways are kinetically accessible at room temperature (r.t.), and both lead to formation of a delocalized aryl radical anion (I2), with deprotonation by the phthalimide anion (−16.8 kcal mol−1) more thermodynamically favoured than with DABCO (−9.0 kcal mol−1). In our optimized substrate scope conditions where we utilize 5 mol% Cs2CO3, the carbonate acts as a sacrificial Brønsted base in the initial stages of the reaction in a highly thermodynamically favoured deprotonation (−45.3 kcal mol−1; Supplementary Section 6.5). The favourable deprotonation accelerates the reaction by enabling further fragmentation and base generation through the propagative chain reaction rather than waiting for the slower EDA fragmentation to produce higher concentrations of base (Fig. a,b, Experimental kinetic studies monitored by 1H NMR spectroscopy. Standard kinetic conditions: RAE (1) = 0.15 M, 1 equiv. ; 450 nm LED; DMSO. The reported data correspond to mean conversions from three kinetic runs with standard deviations. KPhtl, potassium phthalimide; KPhtl-Cl, potassium tert-chlorophthalimide; Phtl-H, phthalimide; Std., standard conditions. c,d, Simulated time and concentration profiles via microkinetic modelling using DFT-computed Gibbs energies (Supplementary Fig. 6.7.1 and Supplementary Table 6.7.2) under standard kinetic conditions (c) and under standard kinetic conditions with the addition of KPhtl (d) (0.2 equiv.). e, Characterization of the EDA complex via UV–vis spectra: RAE (1) = 0.15 M, 1 equiv. ; DMSO; path length = 1 mm. The vertical line at 450 nm represents the irradiative wavelength of the blue LED. Inset: Job plot with absorbance at 450 nm (Supplementary Section 7.3). f, Cyclic voltammograms (100 mV s−1) of phthalonitrile (10 mM), 4-(1-methylcyclohexyl)phthalonitrile (2, 10 mM), methylcyclohexyl RAE (1, 10 mM) and [nBu4N]+[PF6]− (100 mM) in DMSO under N2 in contact with a glassy-carbon-disc working electrode (0.071 cm2) with potential normalized to the ferrocene (Fc/Fc+) redox couple. Cyano-aryl radical anions, analogous to I2, are readily generated and have been demonstrated previously via SET using electrochemistry, being used both as a reagent and as an electron shuttle to reduce a reagent in situ, as in our proposed mechanism29,39,40. Chemical generation of this radical anionic intermediate is known via base-assisted homolytic aromatic substitution with deprotonation of an aryl radical via addition of a superstoichiometric base. However, this strategy has been limited to a highly restricted synthetic scope, and it relies on the use of highly pyrophoric or toxic reagents4,41,42,43,44. The unpaired electron of the aryl radical anion I2 then undergoes SET to form the desired product. Direct reduction of the RAE by I2 has a barrier of only +0.4 kcal mol−1 from Marcus theory, indicating that this SET is diffusion-controlled and the radical anion exists in very low concentrations (Supplementary Section 6.6). The rapid SET to RAE then leads to further fragmentation and chain propagation of the cyclohexyl radical R• (pathway b in Fig. There are two radical-quenching mechanisms that prevent the reaction from being a perfect runaway chain reaction and mean that continued irradiation is required for the reaction to reach completion. The first is that SET can occur from I2 to a DABCO cation (pathway a in Fig. 5), which has an estimated barrier of +9.3 kcal mol−1, and quenches the radical reaction by regenerating DABCO for further EDA complexation, resulting in a net slowing of the reaction rather than termination. An alternative deactivation pathway involves the ester radical anion reducing a DABCO cation to re-form the starting EDA complex (Fig. This process is thermodynamically favourable (−41.3 kcal mol−1) but impractical, as it relies on two short-lived radical species present in low concentrations. The phthalimide anion present within the reaction mixture is formed in situ upon RAE fragmentation and enables this radical anion pathway via deprotonation of I1. Thus, a product of this reaction enables a propagative mechanistic pathway, further accelerating the reaction autocatalytically. However, given the intricacy of the various mechanistic pathways, the precise role of the phthalimide anion has yet to be fully resolved and will require further kinetic and microkinetic studies. The complexity of the deprotonation pathways, as well as their similar kinetic barriers, makes it challenging to directly determine their relative contributions to the overall reaction mechanism. Therefore, the DFT-supported mechanistic hypothesis was probed with experimental kinetic studies (Fig. 6a,b) that were compared with microkinetic modelling (MKM) simulations using the DFT-computed Gibbs energies and activation barriers (Fig. 6c,d and Supplementary Section 6.7). In the experimental kinetic studies, with only DABCO as an additional reagent, we observed two distinct phases of reactivity (Fig. The first phase displayed an initial induction period characterized by very slow reactivity, with less than 3% conversion observed in the first hour. This was followed by a second phase of markedly increased reactivity until completion (Fig. The induction period with slow generation of product P is attributed to the slow and photon-inefficient EDA fragmentation. However, if photolytic EDA fragmentation were the rate-determining step throughout the reaction, the reaction rate should exhibit a slow decline throughout the reaction as the concentration of RAE decreases. Instead, an increasing rate was observed in the second phase, supporting a chain-propagative radical mechanism, which is consistent with previous EDA methodologies45,46. The chain propagation in our proposed mechanism relies on a base to deprotonate the aryl radical adduct (I1 in Fig. This step would be rate-limiting in the initial phase of the reaction, as the basic phthalimide anion is only generated from RAE fragmentation and requires time to accumulate. Thus, adding phthalimide anion into the reaction should increase the rate and eliminate the induction phase. Verifying this hypothesis, the inclusion of phthalimide anion eliminated the slow induction period, resulting in a rapid initial reaction, with higher concentrations of potassium phthalimide correlating with faster reactions (Fig. To confirm that the observed rate increase was due to the availability of a base, the effect of a wider range of inorganic and organic bases was examined, which revealed a clear correlation between increasing reaction rate and increasing base strength (pKaH; Fig. Cs2CO3 enabled the fastest reaction, with completion reached in 3 h (Fig. 6b, black trace), rather than 8 h without base (Fig. 6b, purple trace), all without decreasing the yield. Potassium phthalimide proved slightly slower (Fig. 6b, blue trace), and the less basic tetrachloro-analogue of potassium phthalimide resulted in a less pronounced rate increase (Fig. Conversely, the addition of protonated phthalimide retarded the reaction compared to the addition of no auxiliary base (Fig. Thus, there is a clear correlation between the addition of a base and acceleration of the reaction, which supports a deprotonation step being key to reaction propagation. MKM simulations using the DFT-computed energy barriers replicated the experimental observation of an initial induction phase followed by an acceleration of the reaction rate when no base is added (Fig. Inclusion of the phthalimide anion in the model reduces the induction period and leads to an approximately 50% faster reaction time (Fig. 6d), consistent with the experimental kinetic data (Fig. Furthermore, the simulated concentration profiles from MKM confirm that most product formation arises via the chain-propagation pathway, as radical generation from EDA excitation alone is too slow and photon-inefficient compared to the propagation pathway. The inclusion of base immediately triggers the propagation pathway (Fig. 6d), thereby reducing the reliance on the slow EDA fragmentation until sufficient concentration of base (phthalimide anion) accumulates to enable autocatalysis. Quantum yield experiments also provided further evidence supporting a propagative mechanism, with the estimated chain length of this autocatalytic radical chain reaction calculated to be 17.0 via ferrioxalate actinometry (Supplementary Section 7.1), thus supporting the presence of a highly efficient autocatalytic chain process, consistent with the experimental and computational findings. The combination of the RAE and the amine donor, DABCO, results in EDA complex formation, producing a distinct charge-transfer absorption band. This absorption band tails into the visible range, allowing absorption at 450 nm and consequent photolysis of the RAE (Fig. In contrast, the individual reagents show only negligible absorbance in the visible region (Fig. The measured spectra are consistent with the TD-DFT simulated spectra, showing the EDA complex's absorbance maxima at 368 nm and absorbance tailing well into the visible region (Supplementary Section 6.3). The 1:1 ratio of components within the EDA complex was confirmed via a Job plot, in which the ratio of donor and acceptor is plotted against the maximum absorbance (Fig. Another important mechanistic route considered was the role of the phthalimide anion, formed upon fragmentation of the RAE, as an electron-rich donor that could activate a new EDA complex. This could potentially explain the observed increase in reaction rate upon the addition of KPhtl (Fig. However, DFT calculations indicate that the fragmentation of the putative phthalimide-RAE EDA complex is much less favourable compared with DABCO as the donor (+30.1 versus +3.9 kcal mol−1). The EDA complex with phthalimide anion as a donor has also been shown to have a lower absorbance at 450 nm, resulting in a poorer EDA complex (Supplementary Sections 6.3, 6.5 and 7.2). This is in addition to the fact that the phthalimide anion will not exist in high concentrations during the reaction, as it is protonated over time with the protonated phthalimide-RAE mixture and shows negligible absorbance at 450 nm (Supplementary Fig. Therefore, we find that phthalimide–donor EDA complexes do not play a substantial role in radical formation, especially in the presence of DABCO, which forms a more effective EDA complex chromophore. Additionally, the 5 mol% Cs2CO3 added to accelerate the reaction could similarly act as a donor in a new EDA and not just as a general base. However, the addition of 5 mol% Cs2CO3 does not increase the absorption of the chromophore at 450 nm (Fig. This result, in addition to further control experiments, has led us to conclude that any alternative EDA complexes, formed through the addition of base, do not substantially impact the reaction (Supplementary Sections 6.3, 6.5 and 7.2). The aryl radical anion (I2) is expected to exist only at very low concentrations due to its predicted rapid reaction with RAE, as supported by DFT calculations. The viability of this step was probed by cyclic voltammetry, with phthalonitrile and 4-(1-methylcyclohexyl)phthalonitrile (2) exhibiting half-wave potential reduction potentials (E1/2) of −2.26 V and −2.38 V versus Fc/Fc+, respectively (Fig. Both species are sufficiently negative to reduce the RAE (1), as its reduction potential is −1.62 V versus Fc/Fc+ (Fig. As a result, the radical anion electron can feasibly shuttle from the anionic product (I2) to the phthalonitrile starting material, as evidenced by both the cyclic voltammetry and DFT results (Fig. The subsequent RAE reduction is irreversible and consistent with reduction induced fragmentation. Therefore, the radical anion is sufficiently reducing to undergo SET, reduce the RAE, and thereby propagate the reaction. We also investigated alternative RAEs, although none achieved yields matching our standard phthalimide RAE (Supplementary Section 7.4). In addition, we carried out further mechanistic studies such as TEMPO trapping and a radical clock competition experiment, both of which provided further evidence for the radical-based reaction (Supplementary Section 7.5). Overall, the experimental kinetic data, the role of the base in facilitating reaction propagation (Fig. 6b), the previous literature, DFT calculations (Figs. 4 and 5) and the measured quantum yields (Supplementary Section 7.1) all support the presence of an EDA-triggered autocatalytic radical propagation mechanism via an aryl radical anion intermediate. Typical Friedel–Crafts alkylation proceeds by the attack of a highly electrophilic carbocation towards the most nucleophilic site of an aromatic ring. In contrast, our ‘anti-Friedel–Crafts' selectivity relies on a nucleophilic alkyl radical attacking the most electrophilic site of an aromatic ring1,2. Thus, regioselectivity is largely governed by the ability of each carbon site in the aromatic system to accommodate an additional radical electron, provided steric effects allow the radical approach. We first investigated this using Hammett parameters as electronic descriptors of the aromatic acceptors (Supplementary Section 8.1), but opted for the more precise Fukui indices as a means of predicting selectivity via machine-learning models. The experimental 1H NMR spectroscopy-observed substitution products (Fig. 2) confirm the validity of this approach and can be successfully predicted using Fukui indices, a natural bond orbital (NBO)-based metric that describes the localization of excess electron density at each carbon centre in the aromatic ring, thereby indicating the stability of the corresponding aryl radical intermediate51. A higher Fukui index at a given carbon site corresponds to a greater ability to accommodate an additional electron, making the site more susceptible to attack by the alkyl radical. We note, however, that Fukui indices cannot be quantitatively correlated with selectivity outcomes across different molecules. These indices provide a relative measure of a site's electron-accepting ability within a single molecule, but do not allow for direct comparison between different substrates. Additionally, a limitation of this approach is evident in the case of boscalid (47, Fig. 3), where substantial steric hindrance near the position alpha to the carbonyl group prevents radical attack, despite a high Fukui index at that site. This underscores the need to consider steric effects alongside electronic descriptors to accurately predict regioselectivity. To better account for steric effects, we expanded our dataset to include more aromatic substrates with electron-withdrawing groups, bringing the total to 30 molecules and 124 potentially active sites (Fig. This broader dataset allowed us to assess steric effects on a case-by-case basis and to integrate them alongside electronic factors in our regioselectivity predictions. For each molecule, we defined the alkylation site as the position with the highest Fukui index that is not sterically hindered (for example, ortho to carbonyl or trifluoromethyl groups). Experimental data were then used to validate these predictions, which consistently aligned with the observed regioselectivity. Fukui indices were computed for each carbon position using the total natural population values obtained through NBO analysis (Supplementary Section 8.2). The computed Fukui indices are depicted for each carbon site considered. The sites with the highest Fukui index that are not sterically hindered (for example, by carbonyl or trifluoromethyl groups) are indicated as the predicted alkylation site for each molecule, highlighted with a blue circle. The alkylated position predicted by the XGB classifier, using SOAP features and UFF-optimized geometries, is shown with a dotted circle outline. UFF, universal force field. To automatically incorporate steric effects into the regioselectivity predictions—without requiring manual intervention—we employed ML models. Specifically, we used an eXtreme Gradient Boosting (XGB)52 classifier trained on Smooth Overlap of Atomic Positions (SOAP) descriptors53,54,55. SOAP descriptors are computationally efficient and rely solely on three-dimensional (3D) structures as input, such as those generated from SMILES strings using RDKit (open-source cheminformatics; https://www.rdkit.org). These descriptors encode the precise spatial arrangement and chemical identity of all atoms in the molecule, including the local environment around each carbon site. As previously stated, in our training set, alkylation sites were labelled as the highest Fukui index positions that were not sterically hindered. By providing the model with the full 3D structural context via SOAP descriptors, we enable it to learn this pattern implicitly, predicting the most likely alkylation site only if it satisfies both electronic and steric criteria. This ML-based approach eliminates the need for DFT and NBO calculations in future predictions, offering a faster, automated alternative for regioselectivity prediction (Supplementary Sections 6.1 and 8.2). To evaluate the performance of the ML model, we performed leave-one-group-out cross-validation, using each molecule as an independent group. In this procedure, the classifier was trained on the active sites of all but one molecule, and then used to predict the active site in the excluded molecule. This process was repeated until the alkylation site of every molecule had been predicted once (30 iterations for the 30 molecules). The classifier was trained to assign a probability to each atomic site indicating its likelihood of being reactive; within each molecule, the site with the highest predicted probability was defined as the most likely alkylation site. The XGB classifier correctly predicted the most active site in 28 out of 30 molecules, achieving an accuracy of 93% compared to the experimentally observed alkylation sites (Fig. This high performance is particularly notable given the small dataset of 124 atomic sites and 30 molecules. One incorrectly predicted molecule was 2-(methylsulfonyl)pyrimidine, highlighting a limitation of our dataset—this sulfur-containing molecule was unique, leaving the classifier with no other sulfur-containing examples to learn from, confirming that ML methods perform best for substrates within the same chemical space as the ones on which they have been trained. In addition to XGB, other classification models, including random forest, logistic regression, neural networks and Gaussian process, were tested using the default hyperparameters, achieving comparable or lower performance (Supplementary Section 8.2). Additionally, when comparing the accuracy of these models using SOAP features derived from UFF-optimized geometries with RDKit versus those generated from DFT-relaxed structures (Supplementary Section 8.2), we found no significant difference in performance. Building on the robust performance and efficiency of our model using SOAP features, we next sought to demonstrate the predictive power of the XGB classifier in a real-world setting. For this, we applied the classifier to predict the most active site for four completely new molecules to the model (Supplementary Section 8.2). These predictions, made without the need for DFT calculations, were completed in a matter of seconds on a standard computer using the XGB classifier trained on the 30 known molecules, with SOAP features derived from SMILES strings. Experimental validation using 1H NMR spectroscopy confirmed the accuracy of the model, which correctly identified the most active site for all four new substrates (Supplementary Section 8.2). It is important to note, however, that although the model accurately predicts the most active site, it does not provide information on whether other sites in the molecule may also be active. Overall, our approach demonstrates the potential of ML models to aid in organic synthesis, particularly in predicting regioselectivity for reactions with multiple similar active sites. This opens the door to more efficient and scalable selectivity prediction tools in the future. We have developed a simple, scalable and transition-metal-free method for anti-Friedel–Crafts alkylation of electron-poor aromatics by exploiting the photolytic fragmentation of an EDA complex propagated through radical anion autocatalysis. This autocatalytic mechanism is supported by DFT computation and kinetic evidence, which both demonstrate an increasing reaction rate and an accelerated reaction upon addition of an auxiliary base. Our strategy enables regioselective, photocatalyst-free C–H alkylation using only inexpensive, readily available and non-toxic components. Notably, the catalytic fragmentation of the EDA complex eliminates the need for any exogenous oxidants or reductants. The anti-Friedel–Crafts selectivity observed in this reaction was predicted using DFT-computed Fukui indices. We extended this predictive approach by developing a ML model, which accurately forecasted the regioselectivity of previously ‘unseen' substrates. We envisage further investigations to exploit radical anion autocatalysis for other reactions, as well as the development of alternative propagative mechanisms to exploit EDA fragmentation. The advancement of redox auxiliaries also offers exciting possibilities, both for creating more photon-efficient EDA complexes and for incorporating these complexes productively into catalytic processes, rather than using them merely as disposable redox activators. This photoinitiated anti-Friedel–Crafts alkylation demonstrated excellent functional group tolerance, including in the late-stage modification of pharmaceuticals, while maintaining high regioselectivity. We anticipate that this method will prove to be an effective synthetic strategy, particularly in the context of late-stage modification during drug discovery. A round-bottom flask was charged with N-hydroxyphthalimide (1.1 equiv. ), 4-(dimethylamino)pyridine (DMAP; 0.01 equiv.) and carboxylic acid (1 equiv.) This was followed by portionwise addition of N,N′-dicyclohexylcarbodiimide (DCC; 1.1 equiv.) in DCM (1.0 M) to the stirred round-bottom flask. The reaction mixture was then stirred at r.t. for 18 h. The reaction was filtered, concentrated in vacuo, and purified directly by column chromatography to afford the desired compound. For the anti-Friedel–Crafts alkylation methodology, electron-poor arene (3–5 equiv.) was added to a solution of phthalimide RAE (1 equiv. in DMSO (0.15 M) under N2. The reaction mixture was orbitally stirred in a temperature-controlled photoreactor at 25 °C for 16 h over blue LEDs (λmax = 447 nm). For purification, two separate reaction vials were combined, then H2O (5 ml) and EtOAc (10 ml) were added. The organic layer was separated, and the aqueous layer was extracted twice more with EtOAc (2 × 10 ml). The combined organic layers were washed once with brine (4 ml), dried over Na2SO4, filtered and concentrated in vacuo. The reaction mixture was purified by column chromatography to afford the desired compound. Computational and experimental details, as well as any additional results reported in this work, are provided free of charge in the Supplementary Information, and all of the DFT-optimized structures are openly accessible from the ioChem-BD repository available at https://doi.org/10.19061/iochem-bd-6-417. The primary data supporting the findings of this study are available from the University of Cambridge open-access data repository (https://doi.org/10.17863/CAM.122984). Code and related data for full reproducibility of the machine-learning results are available free of charge from our GitHub repository at https://github.com/CCEMGroupTCD/Fukui-Indices. Friedel, C. & Crafts, J. M. A new general synthetical method of producing hydrocarbons. Shen, Y. et al. Friedel-Crafts alkylation of benzenes substituted with meta-directing groups. Maruoka, K., Ito, M. & Yamamoto, H. Unprecedented nucleophilic addition of organolithiums to aromatic aldehydes and ketones by complexation with aluminum tris(2,6-diphenylphenoxide). Russell, G. A., Chen, P., Kim, B. H. & Rajaratnam, R. Homolytic base-promoted aromatic alkylations by alkylmercury halides. Minisci, F. & Fontana, E. V. F. Recent developments of free-radical substitutions of heteroaromatic bases. Minisci, F., Bernardi, R., Bertini, F., Galli, R. & Perchinummo, M. Nucleophilic character of alkyl radicals—VI: a new convenient selective alkylation of heteroaromatic bases. Recent advances in minisci-type reactions. Han, C. & Buchwald, S. L. Negishi coupling of secondary alkylzinc halides with aryl bromides and chlorides. Sato, Y. et al. Generation of alkyl radical through direct excitation of boracene-based alkylborate. Enabling the cross-coupling of tertiary organoboron nucleophiles through radical-mediated alkyl transfer. Kariofillis, S. K. et al. Using data science to guide aryl bromide substrate scope analysis in a Ni/photoredox-catalyzed cross-coupling with acetals as alcohol-derived radical sources. Mulliken, R. S. Molecular compounds and their spectra. The interaction of electron donors and acceptors. Crisenza, G. E. M., Mazzarella, D. & Melchiorre, P. Synthetic methods driven by the photoactivity of electron donor–acceptor complexes. Wortman, A. K. & Stephenson, C. R. J. EDA photochemistry: mechanistic investigations and future opportunities. Dewanji, A. et al. A general arene C–H functionalization strategy via electron donor–acceptor complex photoactivation. Fu, M.-C., Shang, R., Zhao, B., Wang, B. & Fu, Y. Photocatalytic decarboxylative alkylations mediated by triphenylphosphine and sodium iodide. Davies, J., Booth, S. G., Essafi, S., Dryfe, R. A. W. & Leonori, D. Visible-light-mediated generation of nitrogen-centered radicals: metal-free hydroimination and iminohydroxylation cyclization reactions. & Kornblum, N. Substitution reactions which proceed via radical anion intermediates. Effect of light on electron transfer substitution at a saturated carbon atom. & Kochi, J. K. Annihilation of aromatic cation radicals by ion-pair and radical pair collapse. Unusual solvent and salt effects in the competition for aromatic substitution. Arceo, E., Jurberg, I. D., Álvarez-Fernández, A. & Melchiorre, P. Photochemical activity of a key donor–acceptor complex can drive stereoselective catalytic α-alkylation of aldehydes. Zhao, H., Cuomo, V. D., Rossi-Ashton, J. & Procter, D. J. Aryl sulfonium salt electron donor-acceptor complexes for halogen atom transfer: isocyanides as tunable coupling partners. de Pedro Beato, E., Spinnato, D., Zhou, W. & Melchiorre, P. A general organocatalytic system for electron donor–acceptor complex photoactivation and its use in radical processes. Zhou, W., Wu, S. & Melchiorre, P. Tetrachlorophthalimides as organocatalytic acceptors for electron donor–acceptor complex photoactivation. Wu, J., Grant, P. S., Li, X., Noble, A. & Aggarwal, V. K. Catalyst-free deaminative functionalizations of primary amines by photoinduced single-electron transfer. & Bach, T. 3-Acetoxyquinuclidine as catalyst in electron donor-acceptor complex-mediated reactions triggered by visible light. Hota, S. K. et al. Photoinduced electron donor-acceptor complex-mediated radical cascade involving N-(acyloxy)phthalimides: synthesis of tetrahydroquinolines. McNally, A., Prier, C. K. & MacMillan, D. W. C. Discovery of an α-amino C-H arylation reaction using the strategy of accelerated serendipity. Pirnot, M. T., Rankic, D. A., Martin, D. B. C. & MacMillan, D. W. C. Photoredox activation for the direct β-arylation of ketones and aldehydes. Johnston, B., Loh, D. M. & Nocera, D. G. Substrate-mediator duality of 1,4-dicyanobenzene in electrochemical C(sp2)−C(sp3) bond formation with alkyl bromides. & Shibata, N. Contribution of organofluorine compounds to pharmaceuticals. Britton, R. et al. Contemporary synthetic strategies in organofluorine chemistry. Ogawa, Y., Tokunaga, E., Kobayashi, O., Hirai, K. & Shibata, N. Current contributions of organofluorine compounds to the agrochemical industry. Zon, M. A., Fernández, H., Sereno, L. & Silber, J. J. Electrochemical study of the stability of the electron-donor-acceptor (EDA) complex between N,N,N′,N′-tetramethyl-p-phenylendiamine and m-dinitrobenzene in acetonitrile. & Gryko, D. Pyridine N-oxides as HAT reagents for photochemical C-H functionalization of electron-deficient heteroarenes. Generation of alkoxyl radicals by photoredox catalysis enables selective C(sp3)-H functionalization under mild reaction conditions. Jiao, Z., Lim, L. H., Hirao, H. & Zhou, J. S. Palladium-catalyzed para-selective alkylation of electron-deficient arenes. Ling, T. & Rivas, F. All-carbon quaternary centers in natural products and medicinal chemistry: recent advances. Vitaku, E., Smith, D. T. & Njardarson, J. T. Analysis of the structural diversity, substitution patterns, and frequency of nitrogen heterocycles among US FDA approved pharmaceuticals. Médebielle, M., Pinson, J. & Savéant, J.-M. Electrochemically induced SRN1 substitution of fluorinated aryl halides. Application to the synthesis of fluorinated-aryl heterocycles. Mo, Y. et al. Microfluidic electrochemistry for single-electron transfer redox-neutral reactions. Bowman, W. R. & Storey, J. M. D. Synthesis using aromatic homolytic substitution—recent advances. & Curran, D. P. Organocatalysis and C—H activation meet radical- and electron-transfer reactions. & Trahanovsky, W. S. Homolytic base-promoted aromatic alkylations by alkyl halides. Shirakawa, E., Itoh, K.-I., Higashino, T. & Hayashi, T. tert-Butoxide-mediated arylation of benzene with aryl halides in the presence of a catalytic 1,10-phenanthroline derivative. & Melchiorre, P. Mechanism of the stereoselective α-alkylation of aldehydes driven by the photochemical activity of enamines. Cao, Z.-Y., Ghosh, T. & Melchiorre, P. Enantioselective radical conjugate additions driven by a photoactive intramolecular iminium-ion-based EDA complex. Evans, D. Evans and Ripin pKa Values Compilation, https://organicchemistrydata.org/hansreich/resources/pka/pka_data/evans_pKa_table.pdf Wei, J., Meng, J., Zhang, C., Liu, Y. & Jiao, N. Dioxygen compatible electron donor–acceptor catalytic system and its enabled aerobic oxygenation. Xie, S., Li, D., Huang, H., Zhang, F. & Chen, Y. Intermolecular radical addition to ketoacids enabled by boron activation. Nappi, M., Bergonzini, G. & Melchiorre, P. Metal-free photochemical aromatic perfluoroalkylation of α-cyano arylacetates. Sánchez-Márquez, J. Correlations between Fukui indices and reactivity descriptors based on Sanderson's principle. Chen, T. & Guestrin, C. XGBoost: a scalable tree boosting system. 22nd ACM SIGKDD International Conference on Knowledge Discovery and Data Mining (eds Smola, A. et al.) 785–794 (ACM, 2016). Bartók, A. P., Kondor, R. & Csányi, G. On representing chemical environments. Laakso, J. et al. Updates to the DScribe library: new descriptors and derivatives. Himanen, L. et al. DScribe: library of descriptors for machine learning in materials science. We are grateful for the support of AstraZeneca for a PhD studentship (to D.M.V. ), UK Research & Innovation (UKRI, ERC Advanced Grant EP/X030563/1), the UK's Department of Science, Innovation and Technology and the Royal Academy of Engineering Chair in Emerging Technologies programme (CIET-2324-83), Taighde Eireann – Research Ireland (M.M. SFI-20/FFP-P/8740), the European Commission Horizon Europe Programme under grant agreement no. 101126600, as well as the Research IT Unit of Trinity College Dublin and the DJEI/DES/SFI/HEA Irish Centre for High-End Computing (ICHEC) for the generous provision of computational resources used in this work. We thank R. Phipps, M. Gaunt, L. Castañeda-Losada and D. Kim (Yusuf Hamied Department of Chemistry, University of Cambridge) for helpful discussions. Yusuf Hamied Department of Chemistry, University of Cambridge, Cambridge, UK David M. Vahey, Shannon A. Bonke & Erwin Reisner School of Chemistry, CRANN and AMBER Research Centres, Trinity College Dublin, Dublin, Ireland Manting Mu, Timo Sommer & Max García-Melchor Chemical Development, Pharmaceutical Technology & Development, Operations, AstraZeneca, Macclesfield, UK Early Chemical Development, Pharmaceutical Sciences, R&D, AstraZeneca, Macclesfield, UK Center for Cooperative Research on Alternative Energy (CIC energiGUNE), Basque Research and Technology Alliance (BRTA), Vitoria-Gasteiz, Spain IKERBASQUE, Basque Foundation for Science, Bilbao, Spain Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar Search author on:PubMed Google Scholar performed and analysed the synthetic experiments. performed and analysed the electrochemical experiments. performed the flow experiments. performed the DFT calculations, microkinetic modelling simulations, and selectivity predictions with Fukui and Hammett parameters. implemented the machine-learning selectivity predictions and drafted the computational sections of the manuscript. co-wrote the manuscript with input from all the co-authors. Correspondence to Max García-Melchor or Erwin Reisner. The authors declare no competing interests. Nature Synthesis thanks Travis Dudding, Trevor Hamlin, Lisa Roy and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Primary Handling Editor: Peter Seavill, in collaboration with the Nature Synthesis team. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Experimental details, sections 1–10, Supplementary Figures and Supplementary Tables 3.1.1, 6.1.1, 6.1.2, 6.4.1, 6.6.1, 6.7.1, 6.7.2, 7.1.1, 7.1.2, 7.3.1, 7.4.1, 8.2.1, 8.2.2. Source data for Table 1. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Vahey, D.M., Mu, M., Bonke, S.A. et al. Anti-Friedel–Crafts alkylation via electron donor–acceptor photoinitiation. Version of record: 12 March 2026 Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Provided by the Springer Nature SharedIt content-sharing initiative Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.
Now a pair of studies published today in Astronomy and Astrophysics argue that the sun did not make this journey alone. The Milky Way's dense inner regions formed stars faster and accumulated heavy metals far quicker than the outer edges—and a star with the sun's age and chemical components would not have been able to form at its present location. But to get there required crossing a dramatic border. This bar creates a distinct gravitational phenomenon known as the corotation barrier that prevents inner galaxy stars from migrating to the outskirts. Computer simulations suggest that only about 1 percent of stars born at the sun's presumed original location could successfully breach this barrier to reach our current neighborhood within a 4.6-billion-year time frame. And yet Taniguchi and his colleagues discovered that thousands of “solar twin” stars with a mass and a metal makeup similar to those of the sun managed to do so. If you're enjoying this article, consider supporting our award-winning journalism by subscribing. By purchasing a subscription you are helping to ensure the future of impactful stories about the discoveries and ideas shaping our world today. To catalog these stellar migrants, the researchers turned to the European Space Agency's Gaia satellite, an observatory tracking the positions, movements and wavelengths of light from more than two billion stars. The researchers dug up 6,594 solar twins within roughly 1,000 light-years of Earth. When the scientists looked at the age distribution within their catalog, they saw two distinct peaks: one narrow spike of stars around two billion years old that likely formed locally and another broad, massive grouping of stars between six billion and four billion years old that included our sun—“a large population of stars that migrated from their birthplace to their current positions,” Taniguchi proposes. Alice C. Quillen, a physicist and astronomer at the University of Rochester, who was not involved in Taniguchi's study, warns that there's a chance that the broad peak of solar twins might be an artifact generated by the way Taniguchi's team picked this sample—a mere statistical illusion. “The sample is distance-limited, and most of it would be stars that make it into the solar neighborhood,” Quillen says. This factor could favor stars with more oblong orbits, which tend to be older, because younger stars with circular orbits wouldn't have made it to our vicinity yet. But Taniguchi says his team addressed this bias, finding no strong effect of age on the distribution of orbital shape in solar twins. “The field of galaxy dynamics is itself dynamic,” she says. Jacek Krywko is a freelance writer who covers space exploration, artificial intelligence, computer science and all sorts of engineering wizardry. If you enjoyed this article, I'd like to ask for your support. Scientific American has served as an advocate for science and industry for 180 years, and right now may be the most critical moment in that two-century history. I hope it does that for you, too. If you subscribe to Scientific American, you help ensure that our coverage is centered on meaningful research and discovery; that we have the resources to report on the decisions that threaten labs across the U.S.; and that we support both budding and working scientists at a time when the value of science itself too often goes unrecognized. In return, you get essential news, captivating podcasts, brilliant infographics, can't-miss newsletters, must-watch videos, challenging games, and the science world's best writing and reporting. There has never been a more important time for us to stand up and show why science matters. I hope you'll support us in that mission. Subscribe to Scientific American to learn and share the most exciting discoveries, innovations and ideas shaping our world today.
The young shark measured about 210 cm in length and weighed roughly 80-90 kg. Encounters like this are extremely uncommon in the region, prompting scientists to take a closer look at historical records. Researchers reviewed sightings and reports dating back to 1862, ultimately compiling a comprehensive analysis published in the open access journal Acta Ichthyologica et Piscatoria. The unexpected catch -- considered alongside documented records from the past 160 years -- suggests that great white sharks have never fully disappeared from Mediterranean waters. Instead, scientists describe them as a mysterious or "ghost" population that appears only rarely. Despite their elusive nature, evidence indicates they continue to inhabit the region. Finding younger sharks could indicate that breeding is still taking place somewhere in the Mediterranean, an idea that researchers are eager to investigate further. These sightings remain very rare, but they show a consistent pattern over time. Dr. Báez also addressed the powerful fear that great white sharks often inspire. He explains that better scientific understanding can help change public perception. As populations continue to decline, researchers stress the importance of long term monitoring programs to better understand great white sharks in the Mediterranean. Combining direct sightings with modern tracking technologies could help scientists develop evidence based conservation strategies to protect this iconic predator. "The main idea I want to convey to the public is that these large marine animals have a fundamental role in marine ecosystems. As highly migratory pelagic species, they redistribute energy and nutrients across vast distances. Even in death, their descent to the seafloor provides a critical pulse of nourishment for deep-sea communities," concludes Báez. Bed Bugs Are Terrified of This Simple Thing, Study Finds Scientists Discover Second Pregnancy Rewires the Brain in New Ways Stay informed with ScienceDaily's free email newsletter, updated daily and weekly. Keep up to date with the latest news from ScienceDaily via social networks: Tell us what you think of ScienceDaily -- we welcome both positive and negative comments.
These leafhoppers are usually green and have large eyes. They move by jumping with long hind legs that sit alongside their bodies, giving them a frog-like appearance. Details of Dr. Helden's findings were published in the journal Zootaxa. Before this study, scientists had identified only 375 species of Batracomorphus worldwide, with just two documented in the United Kingdom. All seven newly discovered species were collected using light traps in rainforest areas more than 1,500m above sea level in Uganda's Kibale National Park. Leafhoppers in this genus appear almost identical externally, making visual identification extremely difficult. To distinguish them, scientists must examine the insects' genital structures. This is the only reliable way to tell species apart. Leafhoppers reproduce using what scientists call a "lock and key" system. Dr. Helden, an entomologist and member of the Ecology, Evolution and Environment Research Centre at Anglia Ruskin University (ARU), said: "Leafhoppers are beautiful, endearing creatures. Although some can be pests, and are associated with crops such as maize and rice, overall leafhoppers are a really undervalued group of herbivores. "They are an important source of food for birds and other insects, and their presence is a sign of a healthy ecosystem. "Finding these new species has taken a lot of painstaking fieldwork in the rainforest, dealing with heat and humidity, but it is incredibly satisfying to find species previously unknown to science -- it makes all the hard work worthwhile. "I've named six of the leafhoppers, in Greek, after their distinctive features or where they were found. She bought me my first microscope, which I still have, and encouraged my love of science from the very beginning, so naming a species after her feels like the most fitting tribute I could give." Beyond mRNA: Scientists Turn DNA Origami Into a Powerful New Vaccine Platform JWST Detects Evidence of “Monster Stars” That May Have Created the Universe's First Giant Black Holes Stay informed with ScienceDaily's free email newsletter, updated daily and weekly. Keep up to date with the latest news from ScienceDaily via social networks: Tell us what you think of ScienceDaily -- we welcome both positive and negative comments.